2810004N23Rik Mouse qPCR Primer Pair (NM_025615)

CAT#: MP213619

qSTAR qPCR primer pairs against Mus musculus gene 2810004N23Rik



SensiMix SYBR Master Mix

USD 142.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (3)
2810004N23Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2810004N23 gene (2810004N23Rik)
    • 10 ug

USD 300.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

USD 305.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00

Other products for "2810004N23Rik"

Specifications

Product Data
Gene ID 66523
Forward Sequence CCAAAGAACGGCAGCAAGCTAG
Reverse Sequence GGTTAAACTCCTGAATATCCACATC
Accession No BC023675, NM_025615, NM_025615.1, NM_025615.2, BC087916, BY030694
UniProt ID Q8CIL4
Synonyms 3110004G14Rik; Ayu21-55; Gt(pU21)55Imeg; GtAyu21-55
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.