ATF3 Human qPCR Primer Pair (NM_001674)

CAT#: HP233668

qSTAR qPCR primer pairs against Homo sapiens gene ATF3

Specifications

Product Data

• Gene ID: 467
• Forward Sequence: CGCTGGAATCAGTCACTGTCAG
• Reverse Sequence: CTTGTTTCGGCACTTTGCAGCTG
• Accession No: NM_001674, NM_001674.1, NM_001674.2, NM_001674.3, BC006322, BC006322.2, BI524020, BI819383, BT006996, NM_001674.4
• UniProt ID: P18847
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.