RPS17 Human qPCR Primer Pair (AK097136)

CAT#: HP222689

qSTAR qPCR primer pairs against Homo sapiens gene RPS17



SensiMix SYBR Master Mix

USD 142.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (4)
RPS17 (Myc-DDK-tagged)-Human ribosomal protein S17 (RPS17)
    • 10 ug

USD 150.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

USD 305.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00


RPS17 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00

Other products for "RPS17"

Specifications

Product Data
Gene ID 6218
Forward Sequence ACCTCTGCCAACACACTTTCACG
Reverse Sequence GTATCTGGCAGAGCAAATGGAGG
Accession No BC062715, BC009407, BC019899, BC020453, BC022370, BC049824, BC070222, BC071928, BE905890, BI597659, BM017772, BM457623
UniProt ID P08708
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.