NGLY1 Human qPCR Primer Pair (NM_018297)

CAT#: HP212988

qSTAR qPCR primer pairs against Homo sapiens gene NGLY1



SensiMix SYBR Master Mix

USD 142.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (4)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

USD 305.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00


NGLY1 Antibody - middle region
    • 100 ul

USD 539.00


Lenti ORF particles, NGLY1 (mGFP-tagged)-Human N-glycanase 1 (NGLY1), transcript variant 2, 200ul, >10^7 TU/mL
    • 200 ul

USD 1,142.00

Other products for "NGLY1"

Specifications

Product Data
Gene ID 55768
Forward Sequence CAGCACAAGTAGAACTGACAGGC
Reverse Sequence GTGTTGCCAAGCGACATCACCA
Accession No NM_018297, NM_018297.1, NM_018297.2, NM_018297.3, BC007226, BC007226.1, BC017220, BC000963, BQ017148, NM_018297.4
UniProt ID Q96IV0
Synonyms CDDG; CDG1V; PNG-1; PNG1; PNGase
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.