MEF2B (BORCS8-MEF2B) Human qPCR Primer Pair (NM_005919)

CAT#: HP208964

qSTAR qPCR primer pairs against Homo sapiens gene BORCS8-MEF2B

Specifications

Product Data

• Gene ID: 4207
• Forward Sequence: ATGGACCGTGTGCTGCTGAAGT
• Reverse Sequence: TCCGAAACTTCTCTCCTGGCTC
• Accession No: NM_005919, NM_005919.1, NM_005919.2, NM_005919.3, BC126245, BC136457, BC171767, NM_005919.4
• UniProt ID: Q02080
• Synonyms: LOC729991-MEF2B; MEF2B; MEF2BNB-MEF2B; RSRFR2
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.