Germany
Japan
United Kingdom
China
PI 3 Kinase Class 2A (PIK3C2A) Human qPCR Primer Pair (NM_002645)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
PIK3C2A (Myc-DDK-tagged)-Human phosphoinositide-3-kinase, class 2, alpha polypeptide (PIK3C2A)
USD 1,417.00
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
USD 305.00
Other products for "PIK3C2A"
Specifications
| Product Data | |
| Gene ID | 5286 |
| Forward Sequence | CTTACTCATTGCTTCACCAGTGG |
| Reverse Sequence | GCCTCAATCCAGGTCACAGCTA |
| Accession No | NM_002645, NM_002645.1, NM_002645.2, NM_002645.3, BC113658, BC031681, BC035982, BC040952, BG548448, BX642731, BX648778, NM_002645.4 |
| UniProt ID | O00443 |
| Synonyms | CPK; OCSKD; PI3-K-C2(ALPHA); PI3-K-C2A; PI3K-C2-alpha; PI3K-C2alpha |
| Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.