DLST Human qPCR Primer Pair (NM_001933)

CAT#: HP205700

qSTAR qPCR primer pairs against Homo sapiens gene DLST

Specifications

Product Data

• Gene ID: 1743
• Forward Sequence: AGATGAGGGCTCGGCACAAAGA
• Reverse Sequence: CCACCTCTTTGGTTGTGTCGTC
• Accession No: NM_001933, NM_001933.1, NM_001933.2, NM_001933.3, NM_001933.4, BC001922, BC001922.1, BC000302, BC002735, BM682697, BM928746, BM929953, BU623022, BX248276, BX248764, BX248774
• UniProt ID: P36957
• Synonyms: DLTS; KGD2; PGL7
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.