Leukotriene A4 hydrolase (LTA4H) Human qPCR Primer Pair (NM_000895)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
USD 305.00
LTA4H (Leukotriene A4 hydrolase) mouse monoclonal antibody, clone OTI7D11 (formerly 7D11)
USD 224.00 USD 447.00
Other products for "LTA4H"
Specifications
Product Data | |
Gene ID | 4048 |
Forward Sequence | CAGGCGACAAGTCACTCTCCAA |
Reverse Sequence | GTCCGCAAATGTGGCGTTCCAA |
Accession No | NM_000895, NM_000895.1, NM_000895.2, BC032528, BC032528.1, BC036555, BX647158, NM_000895.3 |
UniProt ID | P09960 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.