IL1 Receptor I (IL1R1) Human qPCR Primer Pair (NM_000877)

CAT#: HP200817

qSTAR qPCR primer pairs against Homo sapiens gene IL1R1



SensiMix SYBR Master Mix

USD 142.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (4)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

USD 305.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00


IL1R1 (Myc-DDK-tagged)-Human interleukin 1 receptor, type I (IL1R1)
    • 10 ug

USD 530.00


Anti-IL1R1 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00

Other products for "IL1R1"

Specifications

Product Data
Gene ID 3554
Forward Sequence GTGCTTTGGTACAGGGATTCCTG
Reverse Sequence CACAGTCAGAGGTAGACCCTTC
Accession No NM_000877, NM_000877.1, NM_000877.2, NM_000877.3, BC075062, BC075062.2, BC067506, BC067507, BC067508, BC075063, BE144272, BQ021163, BX472731, NM_000877.4
UniProt ID P14778
Synonyms CD121A; D2S1473; IL-1R-alpha; IL1R; IL1RA; P80
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.