Met Mouse Gene Knockout Kit (CRISPR)

CAT#: KN309983

Met - mouse gene knockout kit via CRISPR, HDR mediated

Functional Cassette: GFP-puro Luciferase-Puro RFP-BSD mBFP-Neo



HDR-mediated knockout kit validation

  See Other Versions

USD 1,657.00

4 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (2)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

USD 450.00


Met (Myc-DDK-tagged) - Mouse met proto-oncogene (Met)
    • 10 ug

USD 1,769.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Met
Locus ID 17295
Components

KN309983G1, Met gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTTGGTGCAGAGGAGCCATG

KN309983G2, Met gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTTCATCTCAGACTTCACTA

KN309983D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_008591
Synonyms AI838057; c-Met; HGF; HGFR; Par4

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.