APC Human Gene Knockout Kit (CRISPR)
CAT#: KN211629BN
APC - human gene knockout kit via CRISPR, HDR mediated
Functional Cassette: GFP-puro Luciferase-Puro RFP-BSD
HDR-mediated knockout kit validation
USD 1,657.00
4 Weeks*
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | APC |
Locus ID | 324 |
Components |
KN211629G1, APC gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCGACCGGACCCGAGCCCA KN211629G2, APC gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGTGGTACAGAAGCGGGCAA KN211629BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_000038, NM_001127510, NM_001127511, NM_001354895, NM_001354896, NM_001354897, NM_001354898, NM_001354899, NM_001354900, NM_001354901, NM_001354902, NM_001354903, NM_001354904, NM_001354905, NM_001354906 |
UniProt ID | P25054 |
Synonyms | BTPS2; DP2; DP2.5; DP3; GS; PPP1R46 |
Summary | This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Dec 2019] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN211629 | APC - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN211629LP | APC - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN211629RB | APC - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN411629 | APC - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
|
GA100225 | APC CRISPRa kit - CRISPR gene activation of human APC regulator of WNT signaling pathway |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review