Human KMT2D activation kit by CRISPRa

CAT#: GA105405

KMT2D CRISPRa kit - CRISPR gene activation of human lysine methyltransferase 2D


  See Other Versions


Find the corresponding CRISPRi Inhibitor Kit

USD 1,657.00

2 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (2)
Rabbit Polyclonal Mll4 Antibody
    • 100 ul

USD 430.00


MLL2 (Myc-DDK-tagged)-Human myeloid/lymphoid or mixed-lineage leukemia 2 (MLL2)
    • 10 ug

USD 6,603.00

Other products for "KMT2D"

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol KMT2D
Locus ID 8085
Kit Components

GA105405G1, KMT2D gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTCTTCCATCCCCCTCCC

GA105405G2, KMT2D gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCGCCTCATTTACCGCCC

GA105405G3, KMT2D gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCCGCGAAACTAGGACTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_003482
UniProt ID O14686
Synonyms AAD10; ALR; CAGL114; KABUK1; KMS; MLL2; MLL4; TNRC21
Summary The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.