Human KMT2D activation kit by CRISPRa
CAT#: GA105405
KMT2D CRISPRa kit - CRISPR gene activation of human lysine methyltransferase 2D
Find the corresponding CRISPRi Inhibitor Kit
USD 1,657.00
2 Weeks*
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | KMT2D |
Locus ID | 8085 |
Kit Components | GA105405G1, KMT2D gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTCTTCCATCCCCCTCCC GA105405G2, KMT2D gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCGCCTCATTTACCGCCC GA105405G3, KMT2D gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCCGCGAAACTAGGACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_003482 |
UniProt ID | O14686 |
Synonyms | AAD10; ALR; CAGL114; KABUK1; KMS; MLL2; MLL4; TNRC21 |
Summary | The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN421064 | KMT2D - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review