YAP1 (NM_001282101) Human Untagged Clone

CAT#: SC336522

YAP1 (untagged) - Human Yes-associated protein 1 (YAP1), transcript variant 9


  "NM_001282101" in other vectors (2)

Reconstitution Protocol

USD 521.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Mouse Monoclonal YAP1 Antibody (1A12)
    • 100 ul

USD 550.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "YAP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol YAP1
Synonyms COB1; YAP; YAP2; YAP65; YKI
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282101, the custom clone sequence may differ by one or more nucleotides


ATGGATCCCGGGCAGCAGCCGCCGCCTCAACCGGCCCCCCAGGGCCAAGGGCAGCCGCCTTCGCAGCCCC
CGCAGGGGCAGGGCCCGCCGTCCGGACCCGGGCAACCGGCACCCGCGGCGACCCAGGCGGCGCCGCAGGC
ACCCCCCGCCGGGCATCAGATCGTGCACGTCCGCGGGGACTCGGAGACCGACCTGGAGGCGCTCTTCAAC
GCCGTCATGAACCCCAAGACGGCCAACGTGCCCCAGACCGTGCCCATGAGGCTCCGGAAGCTGCCCGACT
CCTTCTTCAAGCCGCCGGAGCCCAAATCCCACTCCCGACAGGCCAGTACTGATGCAGGCACTGCAGGAGC
CCTGACTCCACAGCATGTTCGAGCTCATTCCTCTCCAGCTTCTCTGCAGTTGGGAGCTGTTTCTCCTGGG
ACACTGACCCCCACTGGAGTAGTCTCTGGCCCAGCAGCTACACCCACAGCTCAGCATCTTCGACAGTCTT
CTTTTGAGATACCTGATGATGTACCTCTGCCAGCAGGTTGGGAGATGGCAAAGACATCTTCTGGTCAGAG
ATACTTCTTAAATCACATCGATCAGACAACAACATGGCAGGACCCCAGGAAGGCCATGCTGTCCCAGATG
AACGTCACAGCCCCCACCAGTCCACCAGTGCAGCAGAATATGATGAACTCGGCTTCAGGTCCTCTTCCTG
ATGGATGGGAACAAGCCATGACTCAGGATGGAGAAATTTACTATATAAACCATAAGAACAAGACCACCTC
TTGGCTAGACCCAAGGCTTGACCCTCGTTTTGCCATGAACCAGAGAATCAGTCAGAGTGCTCCAGTGAAA
CAGCCACCACCCCTGGCTCCCCAGAGCCCACAGGGAGGCGTCATGGGTGGCAGCAACTCCAACCAGCAGC
AACAGATGCGACTGCAGCAACTGCAGATGGAGAAGGAGAGGCTGCGGCTGAAACAGCAAGAACTGCTTCG
GCAGGTGAGGCCACAGGCAATGCGGAATATCAATCCCAGCACAGCAAATTCTCCAAAATGTCAGGAGTTA
GCCCTGCGTAGCCAGTTACCAACACTGGAGCAGGATGGTGGGACTCAAAATCCAGTGTCTTCTCCCGGGA
TGTCTCAGGAATTGAGAACAATGACGACCAATAGCTCAGATCCTTTCCTTAACAGTGGCACCTATCACTC
TCGAGATGAGAGTACAGACAGTGGACTAAGCATGAGCAGCTACAGTGTCCCTCGAACCCCAGATGACTTC
CTGAACAGTGTGGATGAGATGGATACAGGTGATACTATCAACCAAAGCACCCTGCCCTCACAGCAGAACC
GTTTCCCAGACTACCTTGAAGCCATTCCTGGGACAAATGTGGACCTTGGAACACTGGAAGGAGATGGAAT
GAACATAGAAGGAGAGGAGCTGATGCCAAGTCTGCAGGAAGCTTTGAGTTCTGACATCCTTAATGACATG
GAGTCTGTTTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTTACATGGTTATAG


Restriction Sites SgfI-MluI     
ACCN NM_001282101
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282101.1, NP_001269030.1
RefSeq Size 5408 bp
RefSeq ORF 1527 bp
Locus ID 10413
UniProt ID P46937
Cytogenetics 11q22.1
Protein Families Druggable Genome
Gene Summary This gene encodes a downstream nuclear effector of the Hippo signaling pathway which is involved in development, growth, repair, and homeostasis. This gene is known to play a role in the development and progression of multiple cancers as a transcriptional regulator of this signaling pathway and may function as a potential target for cancer treatment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (9) represents the longest transcript and encodes the longest isoform (9). The encoded protein represents the YAP1-2delta isoform described in Figure 3 of PMID: 22939869. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.