SLC38A1 (NM_001278388) Human Untagged Clone

CAT#: SC336406

SLC38A1 (untagged) - Human solute carrier family 38, member 1 (SLC38A1), transcript variant 4


  "NM_001278388" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SLC38A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC38A1
Synonyms ATA1; NAT2; SAT1; SNAT1
Vector pCMV6-Entry
Sequence Data
>SC336406 representing NM_001278388.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATGCATTTCAAAAGTGGACTCGAATTAACTGAGTTGCAAAACATGACAGTGCCCGAGGATGATAAC
ATTAGCAATGACTCCAATGATTTCACCGAAGTAGAAAATGGTCAGATAAATAGCAAGTTTATTTCTGAT
CGTGAAAGTAGAAGAAGTCTCACAAACAGCCATTTGGAAAAAAAGAAGTGTGATGAGTATATTCCAGGT
ACAACCTCCTTAGGCATGTCTGTTTTTAACCTAAGCAACGCCATTATGGGCAGTGGGATTTTGGGACTC
GCCTTTGCCCTGGCAAACACTGGAATCCTACTTTTTCTGGTACTTTTGACTTCAGTGACATTGCTGTCT
ATATATTCAATAAACCTCCTATTGATCTGTTCAAAAGAAACAGGCTGCATGGTGTATGAAAAGCTGGGG
GAACAAGTCTTTGGCACCACAGGGAAGTTCGTAATCTTTGGAGCCACCTCTCTACAGAACACTGGAGCA
ATGCTGAGCTACCTCTTCATCGTAAAAAATGAACTACCCTCTGCCATAAAGTTTCTAATGGGAAAGGAA
GAGACATTTTCAGCCTGGTACGTGGATGGCCGCGTTCTGGTGGTGATAGTTACCTTTGGCATAATTCTC
CCTCTGTGTCTCTTGAAGAACTTAGGGTATCTTGGCTATACTAGTGGATTTTCCTTGAGCTGTATGGTT
TTTTTCCTAATTGTGGTTATTTACAAGAAATTTCAAATTCCCTGCATTGTTCCAGAGCTAAATTCAACA
ATAAGTGCTAATTCAACAAATGCTGACACGTGTACGCCAAAATATGTTACCTTCAATTCAAAGACCGTG
TATGCTTTACCCACCATTGCATTTGCATTTGTTTGCCACCCGTCAGTCCTGCCAATTTACAGTGAGCTT
AAAGACCGATCACAGAAAAAAATGCAGATGGTTTCAAACATCTCCTTTTTCGCCATGTTTGTTATGTAC
TTCTTGACTGCCATTTTTGGCTACTTGACATTCTATGACAACGTGCAGTCCGACCTCCTTCACAAATAT
CAGAGTAAAGATGACATTCTCATCCTGACAGTGCGGCTGGCTGTCATTGTTGCTGTGATCCTCACAGTG
CCGGTGTTATTTTTCACGGTTCGTTCATCTTTATTTGAACTGGCTAAGAAAACAAAGTTTAATTTATGT
CGTCATACCGTGGTTACCTGCATACTCTTGGTTGTTATCAACTTGTTGGTGATCTTCATACCCTCCATG
AAGGATATTTTTGGAGTCGTAGGAGTTACATCTGCTAACATGCTTATTTTCATTCTTCCTTCATCTCTT
TATTTAAAAATCACAGACCAGGATGGAGATAAAGGAACTCAAAGAATTTGGGCTGCCCTTTTCTTGGGC
CTGGGGGTGTTGTTCTCCTTGGTCAGCATTCCCTTGGTCATCTATGACTGGGCCTGCTCATCGAGTAGT
GACGAAGGCCACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001278388
Insert Size 1464 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278388.1
RefSeq Size 8385 bp
RefSeq ORF 1464 bp
Locus ID 81539
UniProt ID Q9H2H9
Cytogenetics 12q13.11
Protein Families Transmembrane
MW 54 kDa
Gene Summary Amino acid transporters play essential roles in the uptake of nutrients, production of energy, chemical metabolism, detoxification, and neurotransmitter cycling. SLC38A1 is an important transporter of glutamine, an intermediate in the detoxification of ammonia and the production of urea. Glutamine serves as a precursor for the synaptic transmitter, glutamate (Gu et al., 2001 [PubMed 11325958]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (4) lacks two exons in the 5' UTR, compared to variant 3. Variants 1, 2, 3, 4 and 5 encode the same isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.