alpha Tubulin (TUBA4A) (NM_001278552) Human Untagged Clone

CAT#: SC336095

TUBA4A (untagged) - Human tubulin, alpha 4a (TUBA4A), transcript variant 2


  "NM_001278552" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


alpha Tubulin (4C9) Mouse monoclonal Antibody
    • 100 ul

USD 380.00

Other products for "alpha Tubulin"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol alpha Tubulin
Synonyms ALS22; H2-ALPHA; TUBA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC336095 representing NM_001278552.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCAATGCCTGCTGGGAGCTCTATTGCTTGGAACATGGGATTCAGCCTGATGGGCAGATGCCCAGT
GACAAGACCATTGGTGGAGGGGACGACTCCTTCACCACCTTCTTCTGTGAAACTGGTGCTGGAAAACAC
GTACCCCGGGCAGTTTTTGTGGATCTGGAGCCTACGGTCATTGATGAGATCCGAAATGGCCCATACCGA
CAGCTCTTCCACCCAGAGCAGCTCATCACTGGGAAAGAGGATGCTGCCAACAACTATGCCCGTGGTCAC
TATACCATTGGCAAGGAGATCATTGACCCAGTGCTGGATCGGATCCGCAAGCTGTCTGACCAGTGCACA
GGACTTCAGGGCTTCCTGGTGTTCCACAGCTTTGGTGGGGGCACTGGCTCTGGCTTCACCTCACTCCTG
ATGGAGCGGCTCTCTGTTGACTATGGCAAGAAATCCAAGCTGGAATTCTCCATCTACCCAGCCCCCCAG
GTGTCTACAGCCGTGGTCGAGCCCTACAACTCTATCCTGACCACCCACACCACCCTGGAGCACTCAGAC
TGTGCCTTCATGGTGGACAACGAAGCAATCTATGACATCTGCCGCCGCAACCTAGACATCGAGCGCCCA
ACCTACACCAACCTCAATCGCCTCATTAGCCAAATTGTCTCCTCCATCACAGCTTCTCTGCGCTTTGAC
GGGGCCCTCAATGTGGACCTGACAGAGTTCCAGACCAACCTGGTGCCCTACCCTCGCATCCACTTCCCC
CTGGCCACCTATGCACCAGTCATCTCTGCAGAAAAGGCATACCACGAGCAGCTGTCGGTGGCAGAGATC
ACCAATGCCTGCTTTGAGCCTGCCAACCAGATGGTAAAGTGTGATCCCCGGCACGGCAAGTACATGGCC
TGCTGCCTGCTGTACCGTGGAGATGTGGTGCCCAAGGATGTCAACGCTGCCATTGCCGCCATCAAGACC
AAGCGCAGCATTCAGTTTGTGGACTGGTGCCCCACAGGCTTCAAGGTTGGTATCAACTACCAGCCTCCC
ACTGTGGTGCCTGGGGGTGACCTGGCCAAGGTGCAGCGTGCCGTGTGCATGCTGAGCAACACGACCGCC
ATCGCCGAGGCCTGGGCCCGCCTGGACCACAAGTTCGACCTGATGTATGCCAAGAGGGCGTTTGTGCAC
TGGTATGTGGGTGAGGGCATGGAGGAGGGTGAGTTCTCCGAGGCCCGTGAGGATATGGCTGCCCTGGAG
AAGGATTATGAGGAGGTGGGCATCGACTCCTATGAGGACGAGGATGAGGGAGAAGAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278552
Insert Size 1302 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278552.1
RefSeq Size 2499 bp
RefSeq ORF 1302 bp
Locus ID 7277
UniProt ID P68366
Cytogenetics 2q35
Protein Families Druggable Genome
Protein Pathways Gap junction, Pathogenic Escherichia coli infection
MW 48.3 kDa
Gene Summary Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene encodes an alpha tubulin that is a highly conserved homolog of a rat testis-specific alpha tubulin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (2) contains an alternate 5' exon, which results in translation initiation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.