Somatostatin Receptor 3 (SSTR3) (NM_001278687) Human Untagged Clone

CAT#: SC336003

SSTR3 (untagged) - Human somatostatin receptor 3 (SSTR3), transcript variant 2


  "NM_001278687" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-SSTR3 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Somatostatin Receptor 3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Somatostatin Receptor 3
Synonyms SS-3-R; SS3-R; SS3R; SSR-28
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC336003 representing NM_001278687.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACATGCTTCATCCATCATCGGTGTCCACGACCTCAGAACCTGAGAATGCCTCCTCGGCCTGGCCC
CCAGATGCCACCCTGGGCAACGTGTCGGCGGGCCCAAGCCCGGCAGGGCTGGCCGTCAGTGGCGTTCTG
ATCCCCCTGGTCTACCTGGTGGTGTGCGTGGTGGGCCTGCTGGGTAACTCGCTGGTCATCTATGTGGTC
CTGCGGCACACGGCCAGCCCTTCAGTCACCAACGTCTACATCCTCAACCTGGCGCTGGCCGACGAGCTC
TTCATGCTGGGGCTGCCCTTCCTGGCCGCCCAGAACGCCCTGTCCTACTGGCCCTTCGGCTCCCTCATG
TGCCGCCTGGTCATGGCGGTGGATGGCATCAACCAGTTCACCAGCATATTCTGCCTGACTGTCATGAGC
GTGGACCGCTACCTGGCCGTGGTACATCCCACCCGCTCGGCCCGCTGGCGCACAGCTCCGGTGGCCCGC
ACGGTCAGCGCGGCTGTGTGGGTGGCCTCAGCCGTGGTGGTGCTGCCCGTGGTGGTCTTCTCGGGAGTG
CCCCGCGGCATGAGCACCTGCCACATGCAGTGGCCCGAGCCGGCGGCGGCCTGGCGAGCCGGCTTCATC
ATCTACACGGCCGCACTGGGCTTCTTCGGGCCGCTGCTGGTCATCTGCCTCTGCTACCTGCTCATCGTG
GTGAAGGTGCGCTCAGCTGGGCGCCGGGTGTGGGCACCCTCGTGCCAGCGGCGGCGGCGCTCCGAACGC
AGGGTCACGCGCATGGTGGTGGCCGTGGTGGCGCTCTTCGTGCTCTGCTGGATGCCCTTCTACGTGCTC
AACATCGTCAACGTGGTGTGCCCACTGCCCGAGGAGCCTGCCTTCTTTGGGCTCTACTTCCTGGTGGTG
GCGCTGCCCTATGCCAACAGCTGTGCCAACCCCATCCTTTATGGCTTCCTCTCCTACCGCTTCAAGCAG
GGCTTCCGCAGGGTCCTGCTGCGGCCCTCCCGCCGTGTGCGCAGCCAGGAGCCCACTGTGGGGCCCCCG
GAGAAGACTGAGGAGGAGGATGAGGAGGAGGAGGATGGGGAGGAGAGCAGGGAGGGGGGCAAGGGGAAG
GAGATGAACGGCCGGGTCAGCCAGATCACGCAGCCTGGCACCAGCGGGCAGGAGCGGCCGCCCAGCAGA
GTGGCCAGCAAGGAGCAGCAGCTCCTACCCCAAGAGGCTTCCACTGGGGAGAAGTCCAGCACGATGCGC
ATCAGCTACCTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278687
Insert Size 1257 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278687.2
RefSeq Size 3764 bp
RefSeq ORF 1257 bp
Locus ID 6753
UniProt ID P32745
Cytogenetics 22q13.1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
MW 45.8 kDa
Gene Summary This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) differs in the 5' UTR and represents use of an alternate promoter, compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.