PLAGL1 (NM_001289039) Human Untagged Clone

CAT#: SC335949

PLAGL1 (untagged) - Human pleiomorphic adenoma gene-like 1 (PLAGL1), transcript variant 13


  "NM_001289039" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit polyclonal anti-PLAGL1 antibody
    • 100 ul

USD 380.00

Other products for "PLAGL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLAGL1
Synonyms LOT1; ZAC; ZAC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335949 representing NM_001289039.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTACCCATTCTCCCCAGAAATCTCACCAGTGTGCTCACTGTGAGAAGACGTTCAACCGGAAAGAC
CACCTGAAAAACCACCTCCAGACCCACGACCCCAACAAAATGGCCTTTGGGTGTGAGGAGTGTGGGAAG
AAGTACAACACCATGCTGGGCTATAAGAGGCACCTGGCCCTCCATGCGGCCAGCAGTGGGGACCTCACC
TGTGGGGTCTGTGCCCTGGAGCTAGGGAGCACCGAGGTGCTACTGGACCACCTCAAAGCCCATGCGGAA
GAGAAGCCCCCTAGCGGAACCAAGGAAAAGAAGCACCAGTGCGACCACTGTGAAAGATGCTTCTACACC
CGGAAGGATGTGCGACGCCACCTGGTGGTCCACACAGGATGCAAGGACTTCCTGTGCCAGTTCTGTGCC
CAGAGATTTGGGCGCAAGGATCACCTCACCCGGCATACCAAGAAGACCCACTCACAGGAGCTGATGAAA
GAGAGCTTGCAGACCGGAGACCTTCTGAGCACCTTCCACACCATCTCGCCTTCATTCCAACTGAAGGCT
GCTGCCTTGCCTCCTTTCCCTTTAGGAGCTTCTGCCCAGAACGGGCTTGCAAGTAGCTTGCCAGCTGAG
GTCCATAGCCTCACCCTCAGTCCCCCAGAACAAGCCGCCCAGCCTATGCAGCCGCTGCCAGAGTCCCTG
GCCTCCCTCCACCCCTCGGTATCCCCTGGCTCTCCTCCGCCACCCCTTCCCAATCACAAGTACAACACC
ACTTCTACCTCATACTCCCCACTTGCAAGCCTGCCCCTCAAAGCAGATACTAAAGGTTTTTGCAATATC
AGTTTGTTTGAGGACTTGCCTCTGCAAGAGCCTCAGTCACCTCAAAAGCTCAACCCAGGTTTTGATCTG
GCTAAGGGAAATGCTGGTAAAGTAAACCTGCCCAAGGAGCTGCCTGCAGATGCTGTGAACCTAACAATA
CCTGCCTCTCTGGACCTGTCCCCCCTGTTGGGCTTCTGGCAGCTGCCCCCTCCTGCTACCCAAAATACC
TTTGGGAATAGCACTCTTGCCCTGGGGCCTGGGGAATCTTTGCCCCACAGGTTAAGCTGTCTGGGGCAG
CAGCAGCAAGAACCCCCACTTGCCATGGGCACTGTGAGCCTGGGCCAGCTCCCCCTGCCCCCCATCCCT
CATGTGTTCTCAGCTGGCACTGGCTCTGCCATCCTGCCTCATTTCCATCATGCATTCAGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001289039
Insert Size 1236 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289039.1
RefSeq Size 2760 bp
RefSeq ORF 1236 bp
Locus ID 5325
UniProt ID Q9UM63
Cytogenetics 6q24.2
Protein Families Transcription Factors
MW 44.7 kDa
Gene Summary This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (13, also known as P2H) initiates from the P2 promoter, differs in the 5' UTR and 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (1, also known as ZACdelta2) has a shorter N-terminus than isoform 2. Variants 7, 8, 9, 11, 13, 14, 21, 24, and 26 all encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.