TRIB3 (NM_001301201) Human Untagged Clone

CAT#: SC335782

TRIB3 (untagged) - Human tribbles pseudokinase 3 (TRIB3), transcript variant 6


  "NM_001301201" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TRIB3 mouse monoclonal antibody, clone OTI3C6 (formerly 3C6)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TRIB3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TRIB3
Synonyms C20orf97; NIPK; SINK; SKIP3; TRB3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335782 representing NM_001301201.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTACTTATGCATCTTGCTGTGAAGAATAACAGGATGAGTGCTAATAATGACCATTTCCTGACACCT
ACCTGGCAACAGATGCGAGCCACCCCTCTGGCTGCTCCTGCGGGTTCCCTGTCCAGGAAGAAGCGGTTG
GAGTTGGATGACAACTTAGATACCGAGCGTCCCGTCCAGAAACGAGCTCGAAGTGGGCCCCAGCCCAGA
CTGCCCCCCTGCCTGTTGCCCCTGAGCCCACCTACTGCTCCAGATCGTGCAACTGCTGTGGCCACTGCC
TCCCGTCTTGGGCCCTATGTCCTCCTGGAGCCCGAGGAGGGCGGGCGGGCCTACCAGGCCCTGCACTGC
CCTACAGGCACTGAGTATACCTGCAAGGTGTACCCCGTCCAGGAAGCCCTGGCCGTGCTGGAGCCCTAT
GCGCGGCTGCCCCCGCACAAGCATGTGGCTCGGCCCACTGAGGTCCTGGCTGGTACCCAGCTCCTCTAC
GCCTTTTTCACTCGGACCCATGGGGACATGCACAGCCTGGTGCGAAGCCGCCACCGTATCCCTGAGCCT
GAGGCTGCCGTGCTCTTCCGCCAGATGGCCACCGCCCTGGCGCACTGTCACCAGCACGGTCTGGTCCTG
CGTGATCTCAAGCTGTGTCGCTTTGTCTTCGCTGACCGTGAGAGGAAGAAGCTGGTGCTGGAGAACCTG
GAGGACTCCTGCGTGCTGACTGGGCCAGATGATTCCCTGTGGGACAAGCACGCGTGCCCAGCCTACGTG
GGACCTGAGATACTCAGCTCACGGGCCTCATACTCGGGCAAGGCAGCCGATGTCTGGAGCCTGGGCGTG
GCGCTCTTCACCATGCTGGCCGGCCACTACCCCTTCCAGGACTCGGAGCCTGTCCTGCTCTTCGGCAAG
ATCCGCCGCGGGGCCTACGCCTTGCCTGCAGGCCTCTCGGCCCCTGCCCGCTGTCTGGTTCGCTGCCTC
CTTCGTCGGGAGCCAGCTGAACGGCTCACAGCCACAGGCATCCTCCTGCACCCCTGGCTGCGACAGGAC
CCGATGCCCTTAGCCCCAACCCGATCCCATCTCTGGGAGGCTGCCCAGGTGGTCCCTGATGGACTGGGG
CTGGACGAAGCCAGGGAAGAGGAGGGAGACAGAGAAGTGGTTCTGTATGGCTAG

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001301201
Insert Size 1158 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301201.1
RefSeq Size 2413 bp
RefSeq ORF 1158 bp
Locus ID 57761
UniProt ID Q96RU7
Cytogenetics 20p13
Protein Families Druggable Genome, Protein Kinase, Transcription Factors
MW 42.8 kDa
Gene Summary The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (6) has an alternate 5' UTR exon and an additional exon in the 5' region, which results in an upstream in-frame AUG start codon, compared to variant 1. The resulting isoform (2) has a longer N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.