P2X2 (P2RX2) (NM_001282164) Human Untagged Clone

CAT#: SC335678

P2RX2 (untagged) - Human purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), transcript variant 7


  "NM_001282164" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-P2RX2 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "P2X2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol P2X2
Synonyms DFNA41; P2X2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335678 representing NM_001282164.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGCCGCCCAGCCCAAGTACCCCGCCGGGGCGACCGCCCGGCGCCTGGCCCGGGGCTGCTGGTCC
GCCCTCTGGGACTACGAGACGCCCAAGGTGATCGTGGTGAGGAACCGGCGCCTGGGGGTCCTGTACCGC
GCCGTGCAGCTGCTCATCCTGCTCTACTTCGTGTGGTACGTATTCATCGTGCAGAAAAGCTACCAGGAG
AGCGAGACGGGCCCCGAGAGCTCCATCATCACCAAGGTCAAGGGGATCACCACGTCCGAGCACAAAGTG
TGGGACGTGGAGGAGTACGTGAAGCCCCCCGAGAGCATAAGGGTCCACAACGCCACCTGCCTCTCCGAC
GCCGACTGCGTGGCTGGGGAGCTGGACATGCTGGGAAACGGGGCCCTCCAAGACCTGCGAGGTGTTCGG
CTGGTGCCCGGTGGAAGATGGGGCCTCTGTCAGCCAATTTCTGGGTACGATGGCCCCAAATTTCACCAT
CCTCATCAAGAACAGCATCCACTACCCCAAATTCCACTTCTCCAAGGGCAACATCGCCGACCGCACAGA
CGGGTACCTGAAGCGCTGCACGTTCCACGAGGCCTCCGACCTCTACTGCCCCATCTTCAAGCTGGGCTT
TATCGTGGAGAAGGCTGGGGAGAGCTTCACAGAGCTCGCACACAAGGCAGGGGTGGTGTCATCGGGGTC
ATTATCAACTGGGACTGTGACCTGGACCTGCCTGCATCGGAGTGCAACCCCAAGTACTCCTTCCGGAGG
CTTGACCCCAAGCACGTGCCTGCCTCGTCAGGCTACAACTTCAGGTTTGCCAAATACTACAAGATCAAT
GGCACCACCACCCGCACGCTCATCAAGGCCTACGGGATCCGCATTGACGTCATTGTGCATGGACAGGCC
GGGAAGTTCAGCCTGATTCCCACCATTATTAATCTGGCCACAGCTCTGACTTCCGTCGGGGTGGGCTCC
TTCCTGTGCGACTGGATCTTGCTAACATTCATGAACAAAAACAAGGTCTACAGCCATAAGAAATTTGAC
AAGATGGTGGACACTCCTGCCTCCGAGCCTGCCCAAGCCTCCACACCCACAGACCCCAAAGGTTTGGCT
CAACTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282164
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282164.1
RefSeq Size 1564 bp
RefSeq ORF 1113 bp
Locus ID 22953
UniProt ID Q9UBL9
Cytogenetics 12q24.33
Protein Families Druggable Genome, Ion Channels: ATP Receptors, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
MW 41.4 kDa
Gene Summary The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (7) lacks three alternate in-frame segments in the 5' and 3' ends and two alternate segments in the middle compared to variant 4, that cause a frameshift. The resulting isoform (J) lacks three alternate segments and contains a different internal segment compared to isoform D.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.