ADRM1 (NM_001281437) Human Untagged Clone

CAT#: SC335661

ADRM1 (untagged) - Human adhesion regulating molecule 1 (ADRM1), transcript variant 3


  "NM_001281437" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-ADRM1 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ADRM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ADRM1
Synonyms ARM-1; ARM1; GP110; PSMD16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335661 representing NM_001281437.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACGACCTCAGGCGCGCTCTTTCCAAGCCTGGTGCCAGGCTCTCGGGGCGCCTCCAACAAGTACTTG
GTGGAGTTTCGGGCGGGAAAGATGTCCCTGAAGGGGACCACCGTGACTCCGGATAAGCGGAAAGGGCTG
GTGTACATTCAGCAGACGGACGACTCGCTTATTCACTTCTGCTGGAAGGACAGGACGTCCGGGAACGTG
GAAGACGAACCCAAGACAGACCAGGATGAGGAGCATTGCCGGAAAGTCAACGAGTATCTGAACAACCCC
CCGATGCCTGGGGCGCTGGGGGCCAGCGGAAGCAGCGGCCACGAACTCTCTGCGCTAGGCGGTGAGGGT
GGCCTGCAGAGCCTGCTGGGAAACATGAGCCACAGCCAGCTCATGCAGCTCATCGGACCAGCCGGCCTC
GGAGGACTGGGTGGGCTGGGGGCCCTGACTGGACCTGGCCTGGCCAGCTTACTGGGGAGCAGTGGGCCT
CCAGGGAGCAGCTCCTCCTCCAGCTCCCGGAGCCAGTCGGCAGCGGTCACCCCGTCATCCACCACCTCT
TCCACCCGTGCCACCCCAGCCCCTTCTGCTCCAGCAGCTGCCTCAGCAACTAGCCCGAGCCCCGCGCCC
AGTTCCGGGAATGGAGCCAGCACAGCAGCCAGCCCGACCCAGCCCATCCAGCTGAGCGACCTCCAGAGC
ATCCTGGCCACGATGAACGTACCAGCCGGGCCAGCAGGCGGCCAGCAAGTGGACCTGGCCAGTGTGCTG
ACGCCGGAGATAATGGCTCCCATCCTCGCCAACGCGGATGTCCAGGAGCGCCTGCTTCCCTACTTGCCA
TCTGGGGAGTCGCTGCCGCAGACCGCGGATGAGATCCAGAATACCCTGACCTCGCCCCAGTTCCAGCAG
GCCCTGGGCATGTTCAGCGCAGCCTTGGCCTCGGGGCAGCTGGGCCCCCTCATGTGCCAGTTCGGTCTG
CCTGCAGAGGCTGTGGAGGCCGCCAACAAGGGCGATGTGGAAGCGTTTGCCAAAGCCATGCAGAACAAC
GCCAAGCCCGAGCAGAAAGAGGGCGACACGAAGGACAAGAAGGACGAAGAGGAGGACATGAGCCTGGAC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001281437
Insert Size 1107 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001281437.1
RefSeq Size 1375 bp
RefSeq ORF 1107 bp
Locus ID 11047
UniProt ID Q16186
Cytogenetics 20q13.33
MW 37.5 kDa
Gene Summary This gene encodes a member of the adhesion regulating molecule 1 protein family. The encoded protein is a component of the proteasome where it acts as a ubiquitin receptor and recruits the deubiquitinating enzyme, ubiquitin carboxyl-terminal hydrolase L5. Increased levels of the encoded protein are associated with increased cell adhesion, which is likely an indirect effect of this intracellular protein. Dysregulation of this gene has been implicated in carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks an in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Variants 3 and 4 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.