CERD4 (DPF3) (NM_001280543) Human Untagged Clone

CAT#: SC335657

DPF3 (untagged) - Human D4, zinc and double PHD fingers, family 3 (DPF3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CERD4
• Synonyms: BAF45C; CERD4
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001280543, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGTTCACAGACCTGGAAGAGCCCATCTCTGGATGCCCTGGAGGCCCATGGGCTCTAGGGCTCGGGG
  ACCAGTTCTACAAGGAAGCCATTGAGCACTGCCGGAGTTACAACTCACGGCTGTGTGCAGAGCGCAGCGT
  GCGTCTTCCCTTCCTGGACTCACAGACTGGGGTGGCCCAGAACAACTGCTACATCTGGATGGAGAAGAGG
  CACCGAGGCCCAGGCCTTGCCCCGGGCCAGCTGTATACATACCCTGCCCGCTGCTGGCGCAAGAAGAGAC
  GATTGCACCCACCTGAAGATCCAAAACTGCGGCTGCTGGAGATAAAACCTGAAGTGGAGCTTCCCCTGAA
  GAAGGATGGGTTCACCTCAGAGAGCACCACGCTGGAAGCCTTGCTCCGTGGCGAGGGGGTTGAGAAGAAG
  GTGGATGCCAGGGAGGAGGAAAGCATCCAGGAAATACAGAGGGTTTTGGAAAATGATGAAAATGTAGAAG
  AAGGGAATGAAGAAGAGGATTTGGAAGAGGATATTCCCAAGCGAAAGAACAGGACTAGAGGACGGGCTCG
  CGGCTCTGCAGGGGGCAGGAGGAGGCACGACGCCGCCTCTCAGGAAGACCACGACAAACCTTACGTCTGT
  GACATCTGTGGCAAGCGCTACAAGAACCGACCGGGGCTCAGCTACCACTATGCTCACACTCACCTGGCCA
  GCGAGGAGGGGGATGAAGCTCAAGACCAGGAGACTCGGTCCCCACCCAACCACAGAAATGAGAACCACAG
  GCCCCAGAAAGGACCGGATGGAACAGTCATTCCCAATAACTACTGTGACTTCTGCTTGGGGGGCTCCAAC
  ATGAACAAGAAGAGTGGGCGGCCTGAAGAGCTGGTGTCCTGCGCAGACTGTGGACGCTCTGCTCATTTGG
  GAGGAGAAGGCAGGAAGGAGAAGGAGGCAGCGGCCGCAGCACGTACCACGGAGGACTTATTCGGTTCCAC
  GTCAGAAAGTGACACGTCAACTTTCCACGGCTTTGATGAGGACGATTTGGAAGAGCCTCGCTCCTGTCGA
  GGACGCCGCAGTGGCCGGGGTTCGCCCACAGCAGATAAAAAGGGCAGTTGCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001280543
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001280543.1, NP_001267472.1
• RefSeq Size: 4221 bp
• RefSeq ORF: 1104 bp
• Locus ID: 8110
• UniProt ID: Q92784
• Cytogenetics: 14q24.2
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a member of the D4 protein family. The encoded protein is a transcription regulator that binds acetylated histones and is a component of the BAF chromatin remodeling complex. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is longer than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.