Acid Phosphatase 2 (ACP2) (NM_001302491) Human Untagged Clone

CAT#: SC335613

ACP2 (untagged) - Human acid phosphatase 2, lysosomal (ACP2), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Acid Phosphatase 2
• Synonyms: LAP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335613 representing NM_001302491.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGGCAAGCGGTCCGGCTGGAGCCGGGCGGCTCTCCTCCAGCTCCTTCTCGGCGTGAACCTGGTG
  GTGATGCCGCCCACCCGGGCCCGGAGTCTGCGCTTCGTTACCTTGCTGTACCGCCATGGAGACCGTTCA
  CCAGTGAAGACATATCCCAAGGACCCCTATCAGGAAGAAGAATGGCCCCAGGGGTTTGGTCAGTTAACC
  AAGGAGGGGATGCTACAGCACTGGGAACTGGGCCAGGCCCTGCGGCAGCGCTATCACGGCTTCCTAAAC
  ACCTCTTATCACCGGCAAGAGGTTTATGTGCGAAGCACAGACTTTGACCGGACTCTCATGAGTGCTGAG
  GCCAACCTGGCTGGACTCTTCCCTCCCAACGGGATGCAGCGCTTCAACCCGAACATCTCGTGGCAGCCT
  ATTCCTGTGCACACTGTGCCCATCACTGAGGACAGGCAAACGCACGGGCTGCGCCTGCCGCCCTGGGCC
  TCACCCCAAACCATGCAGCGTCTCAGCCGGCTAAAGGACTTCAGCTTCCGCTTCCTCTTCGGAATCTAC
  CAGCAGGCGGAGAAGGCCCGGCTTCAGGGGGGAGTCCTGCTGGCTCAGATAAGGAAGAACCTGACCCTA
  ATGGCGACCACCTCCCAGCTCCCCAAGCTGCTGGTTTACTCTGCGCACGACACTACCCTGGTTGCCCTG
  CAAATGGCACTGGATGTCTACAATGGTGAACAAGCCCCCTACGCCTCCTGCCACATATTTGAACTGTAC
  CAGGAAGATTCTGGGAATTTCTCAGTGGAGATGTACTTTCGGAACGAGAGTGACAAGGCCCCCTGGCCG
  CTCAGCCTGCCTGGCTGCCCTCACCGCTGCCCACTGCAGGACTTCCTTCGCCTCACAGAGCCCGTCGTG
  CCCAAGGATTGGCAGCAGGAGTGCCAGCTGGCAAGCGGTCCTGCAGACACAGAGGTGATTGTGGCCTTG
  GCTGTATGTGGCTCCATCCTCTTCCTCCTCATAGTGCTGCTCCTCACCGTCCTCTTCCGGATGCAGGCC
  CAGCCTCCTGGCTACCGCCACGTCGCAGATGGGGAGGACCACGCCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302491
• Insert Size: 1083 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302491.1
• RefSeq Size: 1970 bp
• RefSeq ORF: 1083 bp
• Locus ID: 53
• UniProt ID: P11117
• Cytogenetics: 11p11.2|11p12-p11
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Lysosome, Riboflavin metabolism
• MW: 41 kDa
• Gene Summary: The protein encoded by this gene belongs to the histidine acid phosphatase family, which hydrolyze orthophosphoric monoesters to alcohol and phosphate. This protein is localized to the lysosomal membrane, and is chemically and genetically distinct from the red cell acid phosphatase. Mice lacking this gene showed multiple defects, including bone structure alterations, lysosomal storage defects, and an increased tendency towards seizures. An enzymatically-inactive allele of this gene in mice showed severe growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternatively spliced transcript variants have been found for this gene. A C-terminally extended isoform is also predicted to be produced by the use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2017]
  Transcript Variant: This variant (5) lacks two consecutive in-frame exons in the 5' coding region compared to variant 1. The encoded shorter isoform (5) lacks an internal protein segment compared to isoform 1.