Archaemetzincin 2 (AMZ2) (NM_001289056) Human Untagged Clone

CAT#: SC335611

AMZ2 (untagged) - Human archaelysin family metallopeptidase 2 (AMZ2), transcript variant 8


  "NM_001289056" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-AMZ2 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Archaemetzincin 2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Archaemetzincin 2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335611 representing NM_001289056.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAAATAATACGGCACTCCGAACAGACACTAAAAACAGCTCTCATCTCAAAGAACCCAGTGCTTGTA
TCACAGTATGAGAAATTAAATGCTGGGGAACAACGTTTAATGAATGAAGCCTTCCAGCCAGCCAGTGAT
CTCTTTGGACCCATTACCTTGCATTCTCCATCAGATTGGATCACCTCCCACCCTGAGGCTCCCCAAGAC
TTTGAACAGTTCTTCAGTGATCCTTACAGAAAGACACCCTCTCCAAACAAACGCAGCATTTATATACAG
TCCATTGGCTCTCTAGGAAACACCAGAATTATCAGTGAAGAATATATTAAATGGCTCACGGGCTACTGT
AAAGCATATTTCTATGGCTTGAGAGTAAAACTCCTAGAACCAGTTCCTGTTTCTGTAACAAGATGTTCC
TTTAGAGTCAATGAGAACACACACAACCTACAAATTCATGCAGGGGACATCCTGAAGTTCTTGAAAAAG
AAGAAACCTGAAGATGCCTTCTGTGTTGTGGGAATAACAATGATTGATCTTTACCCAAGAGACTCGTGG
AATTTTGTCTTTGGACAGGCCTCTTTGACAGATGGTGTGGGGATATTCAGCTTTGCCAGGTATGGCAGT
GATTTTTATAGCATGCACTATAAAGGCAAAGTGAAGAAGCTCAAGAAAACATCTTCAAGTGACTATTCA
ATTTTCGACAACTATTATATTCCAGAAATAACTAGTGTTTTACTACTTCGATCCTGTAAGACTTTAACC
CATGAGATCGGACACATATTTGGACTGCGACACTGCCAGTGGCTTGCATGCCTCATGCAAGGCTCCAAC
CACTTGGAAGAAGCTGACCGGCGCCCTCTAAACCTTTGCCCTATCTGTTTGCACAAGTTGCAGTGTGCT
GTTGGCTTCAGCATTGTAGAAAGATACAAAGCACTGGTGAGGTGGATTGATGATGAATCTTCTGACACA
CCTGGAGCAACTCCAGAACACAGTCACGAGGATAATGGGAATTTACCGAAACCCGTGGAAGCCTTTAAG
GAATGGAAAGAGTGGATAATAAAATGCCTGGCTGTTCTCCAAAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001289056
Insert Size 1083 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289056.1
RefSeq Size 1498 bp
RefSeq ORF 1083 bp
Locus ID 51321
UniProt ID Q86W34
Cytogenetics 17q24.2
Protein Families Druggable Genome
MW 41.3 kDa
Gene Summary The protein encoded by this gene is a zinc metalloprotease that displays some activity against angiotensin-3. The encoded protein is inhibited by the aminopeptidase inhibitor amastatin, as well as by the general inhibitors o-phenanthroline and batimastat. Defects in this gene may be associated with lung tumorigenesis. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (8) differs in the 5' UTR compared to variant 1. Variants 1-5 and 7-17 all encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.