RPP40 (NM_001286132) Human Untagged Clone

CAT#: SC335468

RPP40 (untagged) - Human ribonuclease P/MRP 40kDa subunit (RPP40), transcript variant 2


  "NM_001286132" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


RPP40 Antibody - N-terminal region
    • 100 ul

USD 539.00

Other products for "RPP40"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPP40
Synonyms bA428J1.3; RNASEP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335468 representing NM_001286132.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCACGCTGCGCCGGCTTCGGGAGGCGCCGCGGCACTTACTGGTTTGCGAGAAATCCAACTTCGGC
AACCACAAGTCGCGCCACCGGCATCTTGTGCAGACGCACTACTATAACTACAGGGTTTCATTTCTCATT
CCTGAATGTGGGATACTATCGGAAGAACTGAAAAACCTGGTCATGAACACTGGACCCTATTACTTTGTG
AAGAATTTACCTCTTCATGAATTAATTACACCTGAATTCATCAGTACCTTTATAAAGAAAGGGAAATTA
ATTTTGTCACTGGATAAAGACACTTATGAAGAAACTGGACTTCAGGGTCATCCATCTCAGTTTTCTGGC
AGAAAAATTATGAAATTTATTGTTTCCATTGATTTGATGGAATTATCCTTAAACTTGGATTCTAAGAAG
TATGAAAGAATATCTTGGTCTTTCAAAGAAAAGAAGCCATTGAAATTTGATTTTCTTTTGGCTTGGCAT
AAAACAGGTTCAGAAGAATCGACAATGATGTCATATTTTTCCAAGTACCAAATTCAGGAGCATCAGCCA
AAAGTAGCACTGAGCACGTTGAGAGATCTCCAGTGCCCAGTGCTGCAGAGCAGCGAGCTGGAGGGAACG
CCAGAGGTGTCCTGCCGGGCTCTGGAGCTCTTCGACTGGCTCGGCGCCGTCTTCAGTAATGTCGACCTA
AATAATGAGCCTAATAATTTCATATCAACCTATTGCTGTCCTGAGCCAAGCACAGTGGTGGCAAAAGCT
TATTTGTGTACAATCACTGGCTTCATACTTCCAGAGAAGATCTGTCTCCTATTGGAACATCTCTGTCAC
TACTTTGATGAACCGAAGTTAGCTCCATGGGTTACACTGTCCGTTCAAGGCTTTGCAGACAGCCCTGTT
TCTTGGGAAAAAAATGAACATGGTTTTCGAAAAGGAGGAGAACATTTATATAACTTTGTGATTTTTAAT
AATCAGGACTATTGGCTTCAGATGGCTGTTGGGGCAAATGATCACTGTCCACCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286132
Insert Size 1023 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286132.1
RefSeq Size 1131 bp
RefSeq ORF 1023 bp
Locus ID 10799
UniProt ID O75818
Cytogenetics 6p25.1
Protein Families Stem cell - Pluripotency
MW 39.3 kDa
Gene Summary Component of ribonuclease P, a ribonucleoprotein complex that generates mature tRNA molecules by cleaving their 5'-ends (PubMed:9630247, PubMed:30454648). Also a component of the MRP ribonuclease complex, which cleaves pre-rRNA sequences (PubMed:28115465).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.