CysLT1 (CYSLTR1) (NM_001282188) Human Untagged Clone

CAT#: SC335442

CYSLTR1 (untagged) - Human cysteinyl leukotriene receptor 1 (CYSLTR1), transcript variant 4


  "NM_001282188" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-CYSLTR1 Antibody (C-Terminus)
    • 50 ug

USD 515.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CysLT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CysLT1
Synonyms CYSLT1; CYSLT1R; CYSLTR; HMTMF81
Vector pCMV6-Entry
Sequence Data
>SC335442 representing NM_001282188.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGATGAAACAGGAAATCTGACAGTATCTTCTGCCACATGCCATGACACTATTGATGACTTCCGCAAT
CAAGTGTATTCCACCTTGTACTCTATGATCTCTGTTGTAGGCTTCTTTGGCAATGGCTTTGTGCTCTAT
GTCCTCATAAAAACCTATCACAAGAAGTCAGCCTTCCAAGTATACATGATTAATTTAGCAGTAGCAGAT
CTACTTTGTGTGTGCACACTGCCTCTCCGTGTGGTCTATTATGTTCACAAAGGCATTTGGCTCTTTGGT
GACTTCTTGTGCCGCCTCAGCACCTATGCTTTGTATGTCAACCTCTATTGTAGCATCTTCTTTATGACA
GCCATGAGCTTTTTCCGGTGCATTGCAATTGTTTTTCCAGTCCAGAACATTAATTTGGTTACACAGAAA
AAAGCCAGGTTTGTGTGTGTAGGTATTTGGATTTTTGTGATTTTGACCAGTTCTCCATTTCTAATGGCC
AAACCACAAAAAGATGAGAAAAATAATACCAAGTGCTTTGAGCCCCCACAAGACAATCAAACTAAAAAT
CATGTTTTGGTCTTGCATTATGTGTCATTGTTTGTTGGCTTTATCATCCCTTTTGTTATTATAATTGTC
TGTTACACAATGATCATTTTGACCTTACTAAAAAAATCAATGAAAAAAAATCTGTCAAGTCATAAAAAG
GCTATAGGAATGATCATGGTCGTGACCGCTGCCTTTTTAGTCAGTTTCATGCCATATCATATTCAACGT
ACCATTCACCTTCATTTTTTACACAATGAAACTAAACCCTGTGATTCTGTCCTTAGAATGCAGAAGTCC
GTGGTCATAACCTTGTCTCTGGCTGCATCCAATTGTTGCTTTGACCCTCTCCTATATTTCTTTTCTGGG
GGTAACTTTAGGAAAAGGCTGTCTACATTCAGAAAGCATTCTTTGTCCAGCGTGACTTATGTACCCAGA
AAGAAGGCCTCTTTGCCAGAAAAAGGAGAAGAAATATGTAAAGTATAG

Restriction Sites SgfI-MluI     
ACCN NM_001282188
Insert Size 1014 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282188.1
RefSeq Size 2840 bp
RefSeq ORF 1014 bp
Locus ID 10800
UniProt ID Q9Y271
Cytogenetics Xq21.1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
MW 38.5 kDa
Gene Summary This gene encodes a member of the G-protein coupled receptor 1 family. The encoded protein is a receptor for cysteinyl leukotrienes, and is involved in mediating bronchoconstriction via activation of a phosphatidylinositol-calcium second messenger system. Activation of the encoded receptor results in contraction and proliferation of bronchial smooth muscle cells, eosinophil migration, and damage to the mucus layer in the lung. Upregulation of this gene is associated with asthma and dysregulation may also be implicated in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, and 4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.