WWOX (NM_001291997) Human Untagged Clone

CAT#: SC335202

WWOX (untagged) - Human WW domain containing oxidoreductase (WWOX), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WWOX
• Synonyms: D16S432E; DEE28; EIEE28; FOR; FRA16D; HHCMA56; PRO0128; SCAR12; SDR41C1; WOX1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335202 representing NM_001291997.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAAATTCTCCAGGGCCGGGATTTCACTGGCAAAGTGGTTGTGGTCACTGGAGCTAATTCAGGAATA
  GGGTTCGAAACCGCCAAGTCTTTTGCCCTCCATGGTGCACATGTGATCTTGGCCTGCAGGAACATGGCA
  AGGGCGAGTGAAGCAGTGTCACGCATTTTAGAAGAATGGCATAAAGCCAAGGTAGAAGCAATGACCCTG
  GACCTCGCTCTGCTCCGTAGCGTGCAGCATTTTGCTGAAGCATTCAAGGCCAAGAATGTGCCTCTTCAT
  GTGCTTGTGTGCAACGCAGCAACTTTTGCTCTACCCTGGAGTCTCACCAAAGATGGCCTGGAGACCACC
  TTTCAAGTGAATCATCTGGGGCACTTCTACCTTGTCCAGCTCCTCCAGGATGTTTTGTGCCGCTCAGCT
  CCTGCCCGTGTCATTGTGGTCTCCTCAGAGTCCCATCGATTTACAGATATTAACGACTCCTTGGGAAAA
  CTGGACTTCAGTCGCCTCTCTCCAACAAAAAACGACTATTGGGCGATGCTGGCTTATAACAGGTCCAAG
  CTCTGCAACATCCTCTTCTCCAACGAGCTGCACCGTCGCCTCTCCCCACGCGGGGTCACGTCGAACGCA
  GTGCATCCTGGAAATATGATGTACTCCAACATTCATCGCAGCTGGTGGGTGTACACACTGCTGTTTACC
  TTGGCGAGGCCTTTCACCAAGTCCATGCAACAGGGAGCTGCCACCACCGTGTACTGTGCTGCTGTCCCA
  GAACTGGAGGGTCTGGGAGGGATGTACTTCAACAACTGCTGCCGCTGCATGCCCTCACCAGAAGCTCAG
  AGCGAAGAGACGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGCTGATCCAAGAACGGCTTGGCAGCCAG
  TCCGGCTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291997
• Insert Size: 906 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291997.1
• RefSeq Size: 2440 bp
• RefSeq ORF: 906 bp
• Locus ID: 51741
• UniProt ID: Q9NZC7
• Cytogenetics: 16q23.1-q23.2
• Protein Families: Druggable Genome
• MW: 33.6 kDa
• Gene Summary: This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
  Transcript Variant: This variant (4) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1.