PSMG1 (NM_001261824) Human Untagged Clone
CAT#: SC335058
PSMG1 (untagged) - Human proteasome (prosome, macropain) assembly chaperone 1 (PSMG1), transcript variant 3
"NM_001261824" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "PSMG1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PSMG1 |
Synonyms | C21LRP; DSCR2; LRPC21; PAC-1; PAC1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001261824, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCCACGTTCTTCGGAGAGGTGGTGAAGGCGCCGTGCCGAGCTGGGACTGAGGACGAAGAGGAGG AGGAGGAGGGGCGGAGGGAGACGCCCGAGGACAGGGAGGTGCGTCTGCAGCTGGCGCGGAAGAGGGAAGT GCGGCTCCTTCGAAGACAAACAAAAACATCTTTGGAAGTTTCTTTGCTAGAAAAATATCCGTGCTCCAAG TTTATAATTGCTATAGGAAATAATGCAGTAGCATTTCTGTCATCATTTGTTATGAATTCAGGAGTCTGGG AGGAAGTTGGTTGTGCTAAACTCTGGAATGAATGGTGTAGAACAACAGACACTACACATCTGTCCTCCAC AGAGGCTTTTTGTGTGTTTTATCATCTAAAATCCAATCCCTCGTGCAGTTGCTATGTTGCAGAAGATCAA CAGTATCAGTGGCTGGAAAAGGTTTTTGGCTCTTGTCCAAGGAAGAACATGCAGATAACTATTCTCACAT GTCGACATGTTACCGATTATAAAACCTCAGAATCCACCGGCAGCCTTCCTTCTCCTTTCCTGAGAGCCCT AAAAACACAGAATTTCAAAGACTCGGCGTGTTGTCCATTGCTAGAACAACCGAATATAGTACACGACCTT CCTGCAGCAGTTCTAAGCTACTGTCAAGTATGGAAAATCCCAGCAATTCTGTACTTGTGTTATACTGATG TGATGAAATTAGACCTAATCACAGTGGAAGCTTTTAAGCCTATACTTTCTACCAGAAGCTTGAAGGGTTT GGTTAAGAATATTCCCCAAAGCACTGAGATACTAAAGAAATTGATGACAACAAATGAGATTCAGAGTAAC ATTTATACATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001261824 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001261824.1, NP_001248753.1 |
RefSeq Size | 1125 bp |
RefSeq ORF | 852 bp |
Locus ID | 8624 |
Cytogenetics | 21q22.2 |
Gene Summary | Chaperone protein which promotes assembly of the 20S proteasome as part of a heterodimer with PSMG2. The PSMG1-PSMG2 heterodimer binds to the PSMA5 and PSMA7 proteasome subunits, promotes assembly of the proteasome alpha subunits into the heteroheptameric alpha ring and prevents alpha ring dimerization.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate splice site in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.