VTA1 (NM_001286371) Human Untagged Clone

CAT#: SC335033

VTA1 (untagged) - Human vesicle (multivesicular body) trafficking 1 (VTA1), transcript variant 2


  "NM_001286371" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


VTA1 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "VTA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VTA1
Synonyms C6orf55; DRG-1; DRG1; HSPC228; LIP5; My012; SBP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286371, the custom clone sequence may differ by one or more nucleotides


ATGGCCGCGCTTGCACCGCTGCCCCCGCTCCCCGCACAGTTCAAGAGCATACAGCATCATCTGAGGACGG
CTCAGGAGCATGACAAGCGAGACCCTGTGGTGGCTTATTACTGTCGTTTATACGCAATGCAGACTGGAAT
GAAGATCGATAGTAAAACTCCTGAATGTCGCAAATTTTTATCAAAGTTAATGGATCAGTTAGAAGCTCTA
AAGAAGCAGTTGGGTGATAATGAAGCTATTACTCAAGAAATAGTGGGCTGTGCCCATTTGGAGAATTATG
CTTTGAAAATGTTTTTGTATGCAGACAATGAAGATCGTGCTGGACGATTTCACAAAAACATGATCAAGTC
CTTCTATACTGCAAGTCTTTTGATAGATGTCATAACAGTATTTGGAGAACTCACTGATGAAAATGTGAAA
CACAGGAAGTATGCCAGATGGAAGGCAACATACATCCATAATTGTTTAAAGAATGGGGAGACTCCTCAAG
CAGGCCCTGTTGGAATTGAAGAAGATAATGATATTGAAGAAAATGAAGATGCTGGAGCAGCCTCTCTGCC
CACTCAGCCAACTCAGCCATCATCATCTTCAACTTATGACCCAAGCAACATGCCATCAGGCAACTATACT
GGAATACAGATTCCTCCGGGTGCACACGCTCCAGCTAATACACCAGCAGAAGTGCCTCACAGCACAGGGG
ATGTTCGTCTAACCCCAGAAGACTTTGCTAGAGCTCAGAAGTACTGCAAATATGCTGGCAGTGCTTTGCA
GTATGAAGATGTAAGCACTGCTGTCCAGAATCTACAAAAGGCTCTCAAGTTACTGACGACAGGCAGAGAA
TGA


Restriction Sites SgfI-MluI     
ACCN NM_001286371
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286371.1, NP_001273300.1
RefSeq Size 3290 bp
RefSeq ORF 843 bp
Locus ID 51534
UniProt ID Q9NP79
Cytogenetics 6q24.1-q24.2
Protein Pathways Endocytosis
Gene Summary C6ORF55 encodes a protein involved in trafficking of the multivesicular body, an endosomal compartment involved in sorting membrane proteins for degradation in lysosomes (Ward et al., 2005 [PubMed 15644320]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.