CAPZB (NM_001206541) Human Untagged Clone

CAT#: SC334894

CAPZB (untagged) - Human capping protein (actin filament) muscle Z-line, beta (CAPZB), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CAPZB
• Synonyms: CAPB; CAPPB; CAPZ
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206541, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCCAGGCAGTTCCAGGATACAGGGTTCTCTCGCCCAGGCCTTGGCCAGCCCAGAAGATGTGACCCAG
  AACCTAGAAAGAGTGATCAGCAGCTGGACTGTGCCTTGGACCTAATGAGGCGCCTGCCTCCCCAGCAAAT
  CGAGAAAAACCTCAGCGACCTGATCGACCTGGTCCCCAGTCTATGTGAGGATCTCCTGTCTTCTGTTGAC
  CAGCCACTGAAAATTGCCAGAGACAAGGTGGTGGGAAAGGATTACCTTTTGTGTGACTACAACAGAGATG
  GGGACTCCTATAGGTCACCATGGAGTAACAAGTATGACCCTCCCTTGGAGGATGGGGCCATGCCGTCAGC
  TCGGCTGAGAAAGCTGGAGGTGGAAGCCAACAATGCCTTTGACCAGTATCGAGACCTGTATTTTGAAGGT
  GGCGTCTCATCTGTCTACCTCTGGGATCTGGATCATGGCTTTGCTGGAGTGATCCTCATAAAGAAGGCTG
  GAGATGGATCAAAGAAGATCAAAGGCTGCTGGGATTCCATCCACGTGGTAGAAGTGCAGGAGAAATCCAG
  CGGTCGCACCGCCCATTACAAGTTGACCTCCACGGTGATGCTGTGGCTGCAGACCAACAAATCTGGCTCT
  GGCACCATGAACCTCGGAGGCAGCCTTACCAGACAGATGGAGAAGGATGAAACTGTGAGTGACTGCTCCC
  CACACATAGCCAACATCGGGCGCCTGGTAGAGGTCTGTGCAGACTTTTGCAGACAAATCAAAACAAGAAG
  CTCTGAAGAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206541
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206541.2, NP_001193470.1
• RefSeq Size: 2217 bp
• RefSeq ORF: 783 bp
• Locus ID: 832
• Cytogenetics: 1p36.13
• Gene Summary: This gene encodes the beta subunit of the barbed-end actin binding protein, which belongs to the F-actin capping protein family. The capping protein is a heterodimeric actin capping protein that blocks actin filament assembly and disassembly at the fast growing (barbed) filament ends and functions in regulating actin filament dynamics as well as in stabilizing actin filament lengths in muscle and nonmuscle cells. A pseudogene of this gene is located on the long arm of chromosome 2. Multiple alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (3) differs in both UTR's and has multiple differences in the coding region, compared to variant 1. The encoded protein (isoform 3) has distinct N- and C-termini and is shorter compared to isoform 1.