MDFI (NM_001300806) Human Untagged Clone

CAT#: SC334795

MDFI (untagged) - Human MyoD family inhibitor (MDFI), transcript variant 4


  "NM_001300806" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


MDFI rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "MDFI"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MDFI
Synonyms I-MF; I-mfa
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001300806, the custom clone sequence may differ by one or more nucleotides


ATGTACCAGGTGAGCGGCCAGCGCCCCTCTGGCTGCGACGCGCCCTATGGAGCCCCCAGCGCAGCCCCGG
GCCCAGCCCAGACCCTATCCCTCCTTCCTGGGCTGGAGGTAGTAACAGGATCCACTCACCCTGCGGAGGC
AGCACCAGAGGAGGGCTCCCTGGAGGAGGCGGCAACCCCCATGCCCCAAGGCAATGGCCCTGGCATCCCC
CAGGGCCTGGACAGCACTGACCTCGACGTCCCCACAGAAGCTGTGACATGCCAGCCTCAGGGGAACCCCT
TGGGCTGCACCCCACTTCTGCCGAATGACTCTGGCCACCCCTCAGAGCTGGGCGGCACCAGACGGGCGGG
GAATGGTGCCCTGGGTGGCCCCAAGGCCCACCGGAAGTTGCAGACACACCCATCTCTCGCCAGCCAGGGC
AGCAAGAAGAGTAAGAGCAGCAGCAAATCCACCACCTCCCAGATCCCCCTCCAGGCACAGGAAGACTGCT
GTGTCCACTGCATCCTGTCCTGCCTGTTCTGCGAGTTCCTGACGCTGTGCAACATCGTCCTGGACTGCGC
CACCTGTGGCTCCTGCAGCTCGGAGGACTCGTGCCTCTGCTGCTGCTGCTGTGGCTCTGGCGAGTGTGCC
GACTGCGACCTGCCCTGCGACCTGGACTGCGGCATCCTGGATGCCTGCTGCGAGTCCGCGGACTGCCTGG
AGATCTGCATGGAGTGCTGTGGGCTCTGCTTCTCCTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001300806
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001300806.1, NP_001287735.1
RefSeq Size 1720 bp
RefSeq ORF 741 bp
Locus ID 4188
UniProt ID Q99750
Cytogenetics 6p21.1
Protein Families Transcription Factors
Gene Summary This protein is a transcription factor that negatively regulates other myogenic family proteins. Studies of the mouse homolog, I-mf, show that it interferes with myogenic factor function by masking nuclear localization signals and preventing DNA binding. Knockout mouse studies show defects in the formation of vertebrae and ribs that also involve cartilage formation in these structures. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. It encodes the longer isoform (1). Variants 1, 3, and 4 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.