VSTM2A (NM_001301009) Human Untagged Clone

CAT#: SC334742

VSTM2A (untagged) - Human V-set and transmembrane domain containing 2A (VSTM2A), transcript variant 2


  "NM_001301009" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-VSTM2A Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "VSTM2A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VSTM2A
Synonyms VSTM2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301009, the custom clone sequence may differ by one or more nucleotides


ATGATGGGGATCTTTTTGGTGTATGTTGGATTTGTTTTCTTTTCCGTTTTATATGTACAACAAGGGCTTT
CTTCTCAAGCAAAATTTACCGAGTTTCCGCGGAACGTGACGGCGACCGAGGGGCAGAATGTGGAGATGTC
CTGCGCCTTCCAGAGCGGCTCCGCCTCGGTGTATCTGGAGATCCAATGGTGGTTCCTGCGGGGGCCGGAG
GACCTGGATCCCGGGGCCGAGGGGGCCGGCGCGCAGGTGGAGCTCTTGCCCGACAGAGACCCGGACAGCG
ACGGGACCAAGATCAGCACAGTGAAAGTCCAAGGCAATGACATCTCCCACAAGCTTCAGATTTCCAAAGT
GAGGAAAAAGGATGAAGGCTTATATGAGTGCAGGGTGACTGATGCCAACTACGGGGAGCTTCAGGAACAC
AAGGCCCAGGCCTATCTGAAAGTCAATGCCAACAGCCATGCCCGCAGAATGCAGGCCTTCGAAGCCTCGC
CCATGTGGCTGCAGGATATGAAGCCCCGCAAGAACGTCTCCGCAGCCATCCCCAGCAGCATCCATGGCTC
TGCCAACCAACGAACGCACTCCACCTCCAGCCCTCAAGTGGTAGCCAAAATCCCCAAACAAAGTCCACAA
TCAGCAAAGAGCAAATCGCCTGTAAAATCTACGGAGCGGACAGCAAAGTTGACCCTAAACTCCAAGCACC
ACCCTGCACCCACTGTACTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001301009
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301009.1, NP_001287938.1
RefSeq Size 3000 bp
RefSeq ORF 723 bp
Locus ID 222008
Cytogenetics 7p11.2
Protein Families Secreted Protein, Transmembrane
Gene Summary Plays a role in the regulation of the early stage of white and brown preadipocyte cell differentiation. Promotes adipogenic commitment of preadipocytes by increasing gene expression of the transcription factor PPARG in a BMP4-dependent signaling pathway.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' coding region due to the use of an alternate splice site in the 3'-terminal exon, compared to variant 1. The encoded isoform (2) has a longer and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.