ICT1 (MRPL58) (NM_001303265) Human Untagged Clone
CAT#: SC334631
ICT1 (untagged) - Human immature colon carcinoma transcript 1 (ICT1), transcript variant 2
"NM_001303265" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "MRPL58"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MRPL58 |
Synonyms | DS-1; DS1; ICT1; MRP-L58 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001303265, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCCACCAGGTGCCTGCGCTGGGGCCTGAGCCGAGCCGGAGTCTGGCTGCTCCCACCGCCCGCAC GGTGCCCACGCCGGGCGCTGCACAAGCAGAAAGACGGCACTGAGTTCAAGAGCATCTACAGCCTGGACAA GCTCTACCCCGAATCTCAGGGCTCGGACACCGCCTGGAGGGTCCCGAATGGTGCAAAGCAAGCCGACAGT GACATCCCTCTAGATCGCTTGACAATATCTTATTGTCGGAGTAGTGGTCCTGGGGGGCAGAATGTGAACA AAGTGAATTCCAAGGCAGAAGTCAGGTTCCATTTGGCAACTGCCGAGTGGATCGCGGAGCCCGTGCGGCA GAAGATAGCCATCACGCATAAAAACAAGATCAACAGGTTAGGAGAGTTGATCCTCACCTCTGAGAGCAGC CGCTATCAGTTCCGGAATCTGGCAGATTGCCTGCAGAAAATTCGAGACATGATCACTGAGGCCAGCCAGA CACCGAAGGAGCCAACAAAAGAAGATGTTAAACTTCATAGAATCAGAAAACATGAATCGGGAAAGGCTGA GACAAAAGAGAATTCATTCTGCTGTAAAGACAAGCAGGAGGGTCGACATGGACTGAAATCACCCTCTGCA GCTGGGAGGGCTCTTCTGGGCGTCCGGGCAGCTGCAGCTGAGAGGACTTTCACACCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303265 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001303265.1, NP_001290194.1 |
RefSeq Size | 909 bp |
RefSeq ORF | 690 bp |
Locus ID | 3396 |
UniProt ID | Q14197 |
Cytogenetics | 17q25.1 |
Gene Summary | The protein encoded by this gene is a peptidyl-tRNA hydrolase and a vital component of the large mitochondrial ribosome. The encoded protein serves as a ribosome release factor for this ribosome, which translates mitochondrial genes. This protein may be responsible for degrading prematurely-terminated polypeptides and for reusing stalled ribosomes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (2) uses an alternate splice junction in the 3' coding region compared to variant 1, that causes a frameshift. The resulting isoform (2) has a longer and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.