USP46 (NM_001286768) Human Untagged Clone

CAT#: SC334605

USP46 (untagged) - Human ubiquitin specific peptidase 46 (USP46), transcript variant 4


  "NM_001286768" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
USP46 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "USP46"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol USP46
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286768, the custom clone sequence may differ by one or more nucleotides


ATGCAGCAGGATGCTCATGAATTTTTAAATTATTTGCTAAACACTATTGCGGACATCCTTCAGGAGGAGA
AGAAACAGGAAAAACAAAATGGAAAATTAAAAAATGGCAACATGAACGAACCTGCGGAAAATAATAAACC
AGAACTCACCTGGGTCCATGAGATTTTTCAGGGAACGCTTACCAATGAAACTCGATGCTTGAACTGTGAA
ACTGTTAGTAGCAAAGATGAAGATTTTCTTGACCTTTCTGTTGATGTGGAGCAGAATACATCCATTACCC
ACTGTCTAAGAGACTTCAGCAACACAGAAACACTGTGTAGTGAACAAAAATATTATTGTGAAACATGCTG
CAGCAAACAAGAAGCCCAGAAAAGGATGAGGGTAAAAAAGCTGCCCATGATCTTGGCCCTGCACCTAAAG
CGGTTCAAGTACATGGAGCAGCTGCACAGATACACCAAGCTGTCTTACCGTGTGGTCTTCCCTCTGGAAC
TCCGGCTCTTCAACACCTCCAGTGATGCAGTGAACCTGGACCGCATGTATGACTTGGTTGCGGTGGTCGT
TCACTGTGGCAGTGGTCCTAATCGTGGGCATTATATCACTATTGTGAAAAGTCACGGCTTCTGGCTTTTG
TTTGATGATGACATTGTAGAGGTTGGTTTGCAGATTATTCTCCAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001286768
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286768.1, NP_001273697.1
RefSeq Size 8133 bp
RefSeq ORF 678 bp
Locus ID 64854
UniProt ID P62068
Cytogenetics 4q12
Protein Families Druggable Genome, Protease
Gene Summary Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP46 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Jun 2009]
Transcript Variant: This variant (4) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.