SLC35A2 (NM_001282647) Human Untagged Clone

CAT#: SC334599

SLC35A2 (untagged) - Human solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), transcript variant 4


  "NM_001282647" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
SLC35A2 Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SLC35A2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC35A2
Synonyms CDG2M; CDGX; UDP-Gal-Tr; UGALT; UGAT; UGT; UGT1; UGT2; UGTL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282647, the custom clone sequence may differ by one or more nucleotides


ATGGCAGCGGTTGGGGCTGGTGGTTCCACCGCGGCGCCCGGGCCAGGGGCGGTTTCCGCGGGTGCATTGG
AGCCGGGGACCGCCAGTGCGGCTCACAGGCGCCTGAAGTACATATCCCTAGCTGTGCTGGTGGTCCAGAA
TGCCTCCCTCATCCTCAGCATCCGCTACGCCCGCACGTTGCCAGGGGACCGCTTCTTTGCCACCACTGCT
GTGGTCATGGCGGAAGTGCTCAAAGGTCTCACCTGCCTGCTGCTGCTCTTCGCACAGAAGAGGGGTAACG
TGAAGCACCTGGTTCTCTTCCTCCATGAGGCTGTCCTGGTGCAGTATGTGGACACGCTCAAGCTCGCAGT
GCCCTCTCTCATCTACACCTTGCAGAATAACCTCCAGTATGTTGCCATCTCTAACCTACCAGCTGCCACT
TTCCAGCCTTCCCCGAGGTGCAGCCAAAGCCATAGCCTCTGCCTCTGCCTCCGCCTCCGGGCCCTGCGTT
CACCAGCAGCCTCCCGGGCAGCCACCACCACCGCAGCTGTCTTCCCACCGTGGAGACCTCATCACGGAGC
CCTTTCTGCCAAAGTTGCTCACCAAGGTGAAGGGTTCCTAGCCGCTGGGATTGAAGACATTGGCCTGGCC
TCGTTCTCTCTTCTTGCCCTTGGCCCAGCTGGGACCAAACTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282647
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282647.1, NP_001269576.1
RefSeq Size 1195 bp
RefSeq ORF 675 bp
Locus ID 7355
UniProt ID P78381
Cytogenetics Xp11.23
Protein Families Transmembrane
Gene Summary This gene encodes a member of the nucleotide-sugar transporter family. The encoded protein is a multi-pass membrane protein. It transports UDP-galactose from the cytosol into Golgi vesicles, where it serves as a glycosyl donor for the generation of glycans. Mutations in this gene cause congenital disorder of glycosylation type IIm (CDG2M). Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (4) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (d) is shorter and has a distinct C-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.