GBX2 (NM_001301687) Human Untagged Clone

CAT#: SC334587

GBX2 (untagged) - Human gastrulation brain homeobox 2 (GBX2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GBX2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301687, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCGCAGCGTTCCCGCCGTCGCTGATGATGATGCAGCGCCCGCTGGGGAGTAGCACCGCCTTCAGCA
  TAGACTCGCTGATCGGCAGCCCGCCGCAGCCCAGCCCCGGCCATTTCGTCTACACCGGCTACCCCATGTT
  CATGCCCTACCGGCCGGTAGTGCTGCCGCCGCCGCCGCCGCCGCCGCCCGCGCTGCCCCAGGCCGCGCTG
  CAGCCAGCGCTGCCGCCCGCACACCCTCACCACCAGATCCCCAGCCTGCCCACAGGCTTCTGCTCCAGCC
  TGGCGCAGGGCATGGCGCTCACCTCTACGCTCATGGCCACGCTCCCCGGCGGCTTCTCCGCGTCGCCCCA
  GCACCAGGAGGCGGCAGCGGCCCGCAAGTTCGCGCCGCAGCCGCTGCCCGGCGGCGGTAACTTCGACAAG
  GCGGAGGCGCTGCAGGCTGACGCGGAGGACGGCAAAGGCTTCCTGGCCAAAGAGGGCTCGCTGCTCGCCT
  TCTCCGCGGCCGAGACGGTGCAGGCTTCGCTCGGCCGCCTCTGCCGCTCCGCGGTGACCTGGGGTTCCGG
  TCGGGGCTGTCCGAGGGCAAGGGAAAGACGAGTCAAAGGTGGAAGACGACCCGAAGGGCAAGGAGGAGAG
  CTTCTCGCTGGAGAGCGATGTGGACTACAGCTCGGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301687
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301687.1, NP_001288616.1
• RefSeq Size: 1832 bp
• RefSeq ORF: 669 bp
• Locus ID: 2637
• Cytogenetics: 2q37.2
• Gene Summary: May act as a transcription factor for cell pluripotency and differentiation in the embryo.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains an alternate exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.