AMD1 (NM_001287216) Human Untagged Clone
CAT#: SC334521
AMD1 (untagged) - Human adenosylmethionine decarboxylase 1 (AMD1), transcript variant 5
"NM_001287216" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "AMD1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AMD1 |
Synonyms | ADOMETDC; AMD; SAMDC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287216, the custom clone sequence may differ by one or more nucleotides
ATGGAAGCTGCACATTTTTTCGAAGGGACCGAGAAGCTGCTGGAGGTTTGGTTCTCCCGGCAGCAGCCCG ACGCAAACCAAGGATCTGGGGATCTTCGCACTATCCCAAGGTACTTATATACTCTGGATTTCCCAGAGAG TCGGGTAATCAGTCAGCCAGATCAAACCTTGGAAATTCTGATGAGTGAGCTTGACCCAGCAGTTATGGAC CAGTTCTACATGAAAGATGGTGTTACTGCAAAGGATGTCACTCGTGAGAGTGGAATTCGTGACCTGATAC CAGGTTCTGTCATTGATGCCACAATGTTCAATCCTTGTGGGTATTCGATGAATGGAATGAAATCGGATGG AACTTATTGGACTATTCACATCACTCCAGAACCAGAATTTTCTTATGTTAGCTTTGAAACAAACTTAAGT CAGACCTCCTATGATGACCTGATCAGGAAAGTTGTAGAAGTCTTCAAGCCAGGAAAATTTGTGACCACCT TGTTTGTTAATCAGAGTTCTAAATGTCGCACAGTGCTTGCTTCGCCCCAGAAGATTGAAGGTTTTAAGCG TCTTGATTGCCAGAGTGCTATGTTCAATGATTACAATTTTGTTTTTACCAGTTTTGCTAAGAAGCAGCAA CAACAGCAGAGTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287216 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001287216.1, NP_001274145.1 |
RefSeq Size | 3077 bp |
RefSeq ORF | 645 bp |
Locus ID | 262 |
Cytogenetics | 6q21 |
Protein Families | Druggable Genome |
Protein Pathways | Arginine and proline metabolism, Cysteine and methionine metabolism, Metabolic pathways |
Gene Summary | This gene encodes an important intermediate enzyme in polyamine biosynthesis. The polyamines spermine, spermidine, and putrescine are low-molecular-weight aliphatic amines essential for cellular proliferation and tumor promotion. Multiple alternatively spliced transcript variants have been identified. Pseudogenes of this gene are found on chromosomes 5, 6, 10, X and Y. [provided by RefSeq, Dec 2013] Transcript Variant: This variant (5) lacks consecutive four exons in the coding region, but maintains the reading frame, compared to variant 1. The resulting isoform (5) lacks an internal segment, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.