BCL7B (NM_001301061) Human Untagged Clone

CAT#: SC334507

BCL7B (untagged) - Human B-cell CLL/lymphoma 7B (BCL7B), transcript variant 4


  "NM_001301061" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
BCL7B mouse monoclonal antibody,clone OTI2D9
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "BCL7B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BCL7B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301061, the custom clone sequence may differ by one or more nucleotides


ATGACGGAATCTCGCTCTGTCACCCAGGCTGGAGTGCATTGGCGCAATCTCGGCTCACTGCAACCTCTGC
CTCTCAGGTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGGGAGAAGAAGTGGGT
GACTGTGGGTGACACGTCCCTGAGGATATTTAAGTGGGTTCCTGTGACAGACAGCAAGGAGAAAGAAAAG
TCAAAATCGAACAGTTCAGCAGCCCGAGAACCTAATGGCTTTCCTTCTGATGCCTCAGCCAATTCCTCTC
TCCTTCTTGAATTCCAGGACGAAAACAGCAACCAGAGTTCCGTGTCTGACGTCTATCAGCTTAAGGTGGA
CAGCAGCACCAACTCAAGCCCCAGCCCCCAGCAGAGTGAGTCCCTGAGCCCAGCACACACCTCCGACTTC
CGCACGGATGACTCCCAGCCCCCAACGCTGGGCCAGGAGATCCTGGAGGAGCCCTCCCTGCCCTCCTCGG
AAGTTGCTGATGAACCTCCTACCCTCACCAAGGAAGAACCAGTTCCACTAGAGACACAGGTCGTTGAGGA
AGAGGAAGACTCAGGTGCCCCGCCCCTGAAGCGCTTCTGTGTGGACCAACCCACAGTGCCGCAGACGGCG
TCAGAAAGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001301061
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301061.1, NP_001287990.1
RefSeq Size 1851 bp
RefSeq ORF 642 bp
Locus ID 9275
UniProt ID Q9BQE9
Cytogenetics 7q11.23
Gene Summary This gene encodes a member of the BCL7 family including BCL7A, BCL7B and BCL7C proteins. This member is BCL7B, which contains a region that is highly similar to the N-terminal segment of BCL7A or BCL7C proteins. The BCL7A protein is encoded by the gene known to be directly involved in a three-way gene translocation in a Burkitt lymphoma cell line. This gene is located at a chromosomal region commonly deleted in Williams syndrome. This gene is highly conserved from C. elegans to human. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2010]
Transcript Variant: This variant (4) contains an alternate exon in the 5' coding region and uses an alternate start codon, compared to variant 1. The encoded isoform (3) has a longer and distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.