BCL7B (NM_001301061) Human Untagged Clone
CAT#: SC334507
BCL7B (untagged) - Human B-cell CLL/lymphoma 7B (BCL7B), transcript variant 4
"NM_001301061" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "BCL7B"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BCL7B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001301061, the custom clone sequence may differ by one or more nucleotides
ATGACGGAATCTCGCTCTGTCACCCAGGCTGGAGTGCATTGGCGCAATCTCGGCTCACTGCAACCTCTGC CTCTCAGGTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGGGAGAAGAAGTGGGT GACTGTGGGTGACACGTCCCTGAGGATATTTAAGTGGGTTCCTGTGACAGACAGCAAGGAGAAAGAAAAG TCAAAATCGAACAGTTCAGCAGCCCGAGAACCTAATGGCTTTCCTTCTGATGCCTCAGCCAATTCCTCTC TCCTTCTTGAATTCCAGGACGAAAACAGCAACCAGAGTTCCGTGTCTGACGTCTATCAGCTTAAGGTGGA CAGCAGCACCAACTCAAGCCCCAGCCCCCAGCAGAGTGAGTCCCTGAGCCCAGCACACACCTCCGACTTC CGCACGGATGACTCCCAGCCCCCAACGCTGGGCCAGGAGATCCTGGAGGAGCCCTCCCTGCCCTCCTCGG AAGTTGCTGATGAACCTCCTACCCTCACCAAGGAAGAACCAGTTCCACTAGAGACACAGGTCGTTGAGGA AGAGGAAGACTCAGGTGCCCCGCCCCTGAAGCGCTTCTGTGTGGACCAACCCACAGTGCCGCAGACGGCG TCAGAAAGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301061 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301061.1, NP_001287990.1 |
RefSeq Size | 1851 bp |
RefSeq ORF | 642 bp |
Locus ID | 9275 |
UniProt ID | Q9BQE9 |
Cytogenetics | 7q11.23 |
Gene Summary | This gene encodes a member of the BCL7 family including BCL7A, BCL7B and BCL7C proteins. This member is BCL7B, which contains a region that is highly similar to the N-terminal segment of BCL7A or BCL7C proteins. The BCL7A protein is encoded by the gene known to be directly involved in a three-way gene translocation in a Burkitt lymphoma cell line. This gene is located at a chromosomal region commonly deleted in Williams syndrome. This gene is highly conserved from C. elegans to human. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (4) contains an alternate exon in the 5' coding region and uses an alternate start codon, compared to variant 1. The encoded isoform (3) has a longer and distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.