STMN4 (NM_001283053) Human Untagged Clone
CAT#: SC334429
STMN4 (untagged) - Human stathmin-like 4 (STMN4), transcript variant 2
"NM_001283053" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "STMN4"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | STMN4 |
Synonyms | RB3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001283053, the custom clone sequence may differ by one or more nucleotides
ATGACCCTTGCTGCCTACAAAGAGAAGATGAAGGAGCTCCCGCTGGTGTCCTTGTTCTGCTCCTGCTTCC TGGCCGATCCCCTGAATAAGTCGTCCTACAAATATGAAGGCTGGTGTGGGAGACAGTGTAGGAGGAAGGA TGAAAGCCAGCGGAAAGACAGTGCTGACTGGAGAGAAAGAAGAGCTCAGGCAGACACGGTGGACCTGAAT TGGTGCGTCATTTCCGACATGGAAGTCATCGAGCTGAACAAATGCACCTCGGGCCAATCCTTTGAAGTCA TCCTGAAGCCACCCTCCTTTGATGGGGTTCCCGAGTTCAACGCCTCCCTGCCAAGGCGGCGAGACCCATC CCTGGAAGAGATCCAGAAGAAACTAGAAGCGGCTGAGGAGCGAAGGAAGTACCAGGAAGCGGAGCTCCTG AAACACCTAGCAGAGAAACGGGAACATGAGAGAGAGGTGATCCAAAAGGCCATTGAGGAAAACAACAACT TCATCAAGATGGCTAAGGAAAAACTGGCCCAGAAGATGGAATCCAACAAGGAGAACAGGGAGGCCCACCT CGCCGCCATGTTGGAACGGCTGCAAGAGAAGGAACCGCCTGCTGCGCGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001283053 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001283053.1, NP_001269982.1 |
RefSeq Size | 2406 bp |
RefSeq ORF | 612 bp |
Locus ID | 81551 |
UniProt ID | Q9H169 |
Cytogenetics | 8p21.2 |
Gene Summary | Exhibits microtubule-destabilizing activity.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate exon, which results in a frameshift, compared to variant 1. The resulting protein (isoform 2) has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.