MS4A2 (NM_001256916) Human Untagged Clone
CAT#: SC334407
MS4A2 (untagged) - Human membrane-spanning 4-domains, subfamily A, member 2 (MS4A2), transcript variant 3
"NM_001256916" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "MS4A2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MS4A2 |
Synonyms | APY; ATOPY; FCER1B; FCERI; IGEL; IGER; IGHER; MS4A1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001256916, the custom clone sequence may differ by one or more nucleotides
ATGGACACAGAAAGTAATAGGAGAGCAAATCTTGCTCTCCCACAGGAGCCTTCCAGTGTGCCTGCATTTG AAGTCTTGGAAATATCTCCCCAGGAAGTATCTTCAGGCAGACTATTGAAGTCGGCCTCATCCCCACCACT GCATACATGGCTGACAGTTTTGAAAAAAGAGCAGGAGTTCCTGGGGTTTTCTATTTCTGGAATGTTGTCA ATTATATCTGAAAGGAGAAATGCAACATATCTGGTGAGAGGAAGCCTGGGAGCAAACACTGCCAGCAGCA TAGCTGGGGGAACGGGAATTACCATCCTGATCATCAACCTGAAGAAGAGCTTGGCCTATATCCACATCCA CAGTTGCCAGAAATTTTTTGAGACCAAGTGCTTTATGGCTTCCTTTTCCACTGAAATTGTAGTGATGATG CTGTTTCTCACCATTCTGGGACTTGGTAGTGCTGTGTCACTCACAATCTGTGGAGCTGGGGAAGAACTCA AAGGAAACAAGGTTCCAGAGGATCGTGTTTATGAAGAATTAAACATATATTCAGCTACTTACAGTGAGTT GGAAGACCCAGGGGAAATGTCTCCTCCCATTGATTTATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256916 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256916.1, NP_001243845.1 |
RefSeq Size | 3529 bp |
RefSeq ORF | 600 bp |
Locus ID | 2206 |
Cytogenetics | 11q12.1 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Asthma, Fc epsilon RI signaling pathway |
Gene Summary | The allergic response involves the binding of allergen to receptor-bound IgE followed by cell activation and the release of mediators responsible for the manifestations of allergy. The IgE-receptor, a tetramer composed of an alpha, beta, and 2 disulfide-linked gamma chains, is found on the surface of mast cells and basophils. This gene encodes the beta subunit of the high affinity IgE receptor which is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This family member is localized to 11q12, among a cluster of membrane-spanning 4A gene family members. Alternative splicing results in multiple transcript variants encoding distinct proteins. Additional transcript variants have been described but require experimental validation. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (3) lacks an in-frame exon in the coding region, compared to variant 1, which results in a shorter isoform (3), compared to isoform 1, that traffics to the nuclear membrane. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.