CIB2 (NM_001301224) Human Untagged Clone

CAT#: SC334352

CIB2 (untagged) - Human calcium and integrin binding family member 2 (CIB2), transcript variant 4


  "NM_001301224" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CIB2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CIB2
Synonyms DFNB48; KIP2; USH1J
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301224, the custom clone sequence may differ by one or more nucleotides


ATGGGGAACAAGCAGACCATCTTCACCGAAGAGCAGCTAGACAACTACCAGGACTGCACCTTCTTCAATA
AGAAGGACATCCTCAAATGGGGAAACCGAGGCTCAGAGGGATTTGGTCACTCCTCCAGGGTCACACAGGC
TGTCCACAGTCTGGCTCCGGGGCCCTCCTGCTTATCCTGCACCCACAGTGATTGCTGTGTGTGTTTTCTT
CAGGAGAATCCCTTCAAAGAAAGGATCGTGGCGGCGTTTTCCGAGGATGGTGAGGGGAACCTCACTTTCA
ACGACTTTGTGGACATGTTTTCCGTGCTCTGCGAGTCGGCTCCCCGAGAGCTCAAGGCAAACTATGCCTT
CAAGATCTATGACTTCAACACTGACAACTTCATCTGCAAGGAGGACCTGGAGCTGACGCTGGCCCGGCTC
ACTAAGTCAGAGCTGGATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGG
ACGGTGACGGCAAGCTGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTCCTCAGCAC
TTTCCACATCCGGATCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001301224
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301224.1, NP_001288153.1
RefSeq Size 1638 bp
RefSeq ORF 579 bp
Locus ID 10518
UniProt ID O75838
Cytogenetics 15q25.1
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is similar to that of KIP/CIB, calcineurin B, and calmodulin. The encoded protein is a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs), and it is involved in photoreceptor cell maintenance. Mutations in this gene cause deafness, autosomal recessive, 48 (DFNB48), and also Usher syndrome 1J (USH1J). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) lacks an alternate exon and uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (4) is longer than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.