KCNIP1 (NM_001278340) Human Untagged Clone

CAT#: SC334297

KCNIP1 (untagged) - Human Kv channel interacting protein 1 (KCNIP1), transcript variant 4


  "NM_001278340" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


KCNIP1 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "KCNIP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNIP1
Synonyms KCHIP1; VABP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278340, the custom clone sequence may differ by one or more nucleotides


ATGACCATGGTTTGCCATCGGCCCGAGGGACTGGAGCAGCTCGAGGCCCAGACCAACTTCACCAAGAGGG
AGCTGCAGGTCCTTTATCGAGGCTTCAAAAATGAGTGCCCCAGTGGTGTGGTCAACGAAGACACATTCAA
GCAGATCTATGCTCAGTTTTTCCCTCATGGAGATGCCAGCACGTATGCCCATTACCTCTTCAATGCCTTC
GACACCACTCAGACAGGCTCCGTGAAGTTCGAGGACTTTGTAACCGCTCTGTCGATTTTATTGAGAGGAA
CTGTCCACGAGAAACTAAGGTGGACATTTAATTTGTATGACATCAACAAGGACGGATACATAAACAAAGA
GGAGATGATGGACATTGTCAAAGCCATCTATGACATGATGGGGAAATACACATATCCTGTGCTCAAAGAG
GACACTCCAAGGCAGCATGTGGACGTCTTCTTCCAGAAAATGGACAAAAATAAAGATGGCATCGTAACTT
TAGATGAATTTCTTGAATCATGTCAGGAGGACGACAACATCATGAGGTCTCTCCAGCTGTTTCAAAATGT
CATGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001278340
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278340.1, NP_001265269.1
RefSeq Size 2190 bp
RefSeq ORF 567 bp
Locus ID 30820
UniProt ID Q9NZI2
Cytogenetics 5q35.1
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary This gene encodes a member of the family of cytosolic voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the neuronal calcium sensor (NCS) family of the calcium binding EF-hand proteins. They associate with Kv4 alpha subunits to form native Kv4 channel complexes. The encoded protein may regulate rapidly inactivating (A-type) currents, and hence neuronal membrane excitability, in response to changes in the concentration of intracellular calcium. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
Transcript Variant: This variant (4) differs in the 5' UTR, uses an alternate in-frame splice site in the 5' coding region and initiates translation at a downstream start codon, compared to variant 5. It encodes isoform 4 which is shorter than isoform 5.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.