RNF86 (TRIM2) (NM_001302693) Human Untagged Clone
CAT#: SC334081
TRIM2 (untagged) - Human tripartite motif containing 2 (TRIM2), transcript variant 4
"NM_001302693" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "RNF86"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RNF86 |
Synonyms | CMT2R; RNF86 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC334081 representing NM_001302693.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCACAGGAGTGGCCGTTATGGAACGCAGCAGCGTGCAGGGTCAAAGACAGCCGGCCCCCCATGTCAG TGGTCTAGGATGGCCAGTGAAGGCACCAACATCCCAAGTCCTGTGGTGCGCCAGATTGACAAGCAGTTT CTGATTTGCAGTATATGCCTGGAACGGTACAAGAATCCCAAGGTTCTCCCCTGTCTGCACACTTTCTGC GAGAGGTGCCTGCAGAACTACATTCCTGCCCACAGTTTAACCCTCTCCTGCCCAGTGTGCCGCCAGACC TCCATCCTGCCCGAGAAAGGGGTGGCCGCGCTCCAGAACAATTTCTTCATCACAAACCTGATGGACGTG CTGCAGCGAACTCCAGGCAGCAACGCTGAGGAGTCTTCCATCCTGGAGACAGTCACTGCTGTGGCTGCG GGAAAGCCTCTCTCTTGCCCAAACCACGATGGGAATGTAAGTGGCTGGGATGGCAGATACTGCCCGGGA GCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302693 |
Insert Size | 489 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001302693.1 |
RefSeq Size | 726 bp |
RefSeq ORF | 489 bp |
Locus ID | 23321 |
Cytogenetics | 4q31.3 |
MW | 17.7 kDa |
Gene Summary | The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. It plays a neuroprotective role and functions as an E3-ubiquitin ligase in proteasome-mediated degradation of target proteins. Mutations in this gene can cause early-onset axonal neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (4) uses an alternate in-frame splice site and lacks several 3' exons but contains an alternate 3' terminal exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.