TMEM159 (NM_001301769) Human Untagged Clone

CAT#: SC334073

TMEM159 (untagged) - Human transmembrane protein 159 (TMEM159), transcript variant 3


  "NM_001301769" in other vectors (2)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TMEM159"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM159
Vector pCMV6-Entry
Sequence Data
>SC334073 representing NM_001301769.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAAAAGAGGAGCCCCAGAGTATCTCAAGGGACTTGCAGGAACTGCAGAAGAAGCTGTCTCTGCTG
ATAGACTCCTTCCAGAATAACTCAAAGGTGGTGGCCTTTATGAAGTCTCCAGTGGGTCAGTACTTGGAC
AGCCATCCGTTTCTGGCCTTCACCTTGCTGGTGTTCATTGTCATGTCGGCCGTTCCTGTTGGATTCTTC
CTGCTCATCGTGGTGCTTACCACCCTGGCTGCTCTGCTGGGGGTCATAATATTGGAAGGATTGGTCATC
TCTGTGGGTGGCTTCTCACTGCTCTGCATCCTCTGTGGTTTGGGCTTCGTATCACTCGCCATGTCGGGG
ATGATGATAGCATCTTATGTAGTGGTCTCCAGCCTCATCAGCTGCTGGTTTTCTCCCAGGCCACTGACA
CAGCAAAACACCAGTTGTGACTTTCTGCCAGCCATGAAGTCTGCAGAATTCGAGGGGCTTTACCAGGAA
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001301769
Insert Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301769.1
RefSeq Size 2072 bp
RefSeq ORF 486 bp
Locus ID 57146
UniProt ID Q96B96
Cytogenetics 16p12.3
Protein Families Transmembrane
MW 17.5 kDa
Gene Summary Plays an important role in the formation of lipid droplets (LD) which are storage organelles at the center of lipid and energy homeostasis (PubMed:31708432). In association with BSCL2/seipin, defines the sites of LD formation in the endoplasmic reticulum (PubMed:31708432).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains an alternate exon in the 5' UTR and lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Variants 2, 3, and 4 all encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.