TMEM159 (NM_001301769) Human Untagged Clone
CAT#: SC334073
TMEM159 (untagged) - Human transmembrane protein 159 (TMEM159), transcript variant 3
"NM_001301769" in other vectors (2)
Product Images
Frequently bought together (3)
Other products for "TMEM159"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TMEM159 |
Vector | pCMV6-Entry |
Sequence Data |
>SC334073 representing NM_001301769.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCAAAAGAGGAGCCCCAGAGTATCTCAAGGGACTTGCAGGAACTGCAGAAGAAGCTGTCTCTGCTG ATAGACTCCTTCCAGAATAACTCAAAGGTGGTGGCCTTTATGAAGTCTCCAGTGGGTCAGTACTTGGAC AGCCATCCGTTTCTGGCCTTCACCTTGCTGGTGTTCATTGTCATGTCGGCCGTTCCTGTTGGATTCTTC CTGCTCATCGTGGTGCTTACCACCCTGGCTGCTCTGCTGGGGGTCATAATATTGGAAGGATTGGTCATC TCTGTGGGTGGCTTCTCACTGCTCTGCATCCTCTGTGGTTTGGGCTTCGTATCACTCGCCATGTCGGGG ATGATGATAGCATCTTATGTAGTGGTCTCCAGCCTCATCAGCTGCTGGTTTTCTCCCAGGCCACTGACA CAGCAAAACACCAGTTGTGACTTTCTGCCAGCCATGAAGTCTGCAGAATTCGAGGGGCTTTACCAGGAA TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301769 |
Insert Size | 486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301769.1 |
RefSeq Size | 2072 bp |
RefSeq ORF | 486 bp |
Locus ID | 57146 |
UniProt ID | Q96B96 |
Cytogenetics | 16p12.3 |
Protein Families | Transmembrane |
MW | 17.5 kDa |
Gene Summary | Plays an important role in the formation of lipid droplets (LD) which are storage organelles at the center of lipid and energy homeostasis (PubMed:31708432). In association with BSCL2/seipin, defines the sites of LD formation in the endoplasmic reticulum (PubMed:31708432).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) contains an alternate exon in the 5' UTR and lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Variants 2, 3, and 4 all encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.