AP2S1 (NM_001301078) Human Untagged Clone

CAT#: SC334021

AP2S1 (untagged) - Human adaptor-related protein complex 2, sigma 1 subunit (AP2S1), transcript variant 4


  "NM_001301078" in other vectors (2)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-AP2S1 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "AP2S1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AP2S1
Synonyms AP17; CLAPS2; FBH3; FBHOk; HHC3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334021 representing NM_001301078.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATCCGCTTTATCCTCATCCAGAACCGGGCAGGCAAGACGCGCCTGGCCAAGTGGTACATGCAGTTT
GATGATGATGAGAAACAGAAGCTGATCGAGGAGGTGCATGCCGTGGTCACCGTCCGAGACGCCAAACAC
ACCAACTTTGTGGAGGTCCTGGCAATCTCCGTTGCTGACAGCCTCTCTGTTCTGCAGTTCCGGAACTTT
AAGATCATTTACCGCCGCTATGCTGGCCTCTACTTCTGCATCTGTGTGGATGTCAATGACAACAACCTG
GCTTACCTGGAGGCCATTCACAACTTCGTGGAGGTCTTAAACGAATATTTCCACAATGTCTGTGAACTG
GACCTGGTGTTCAACTTCTACAAGGTTTACACGGTCGTGGACGAGATGTTCCTGGCTGGCGAAATCCGA
GAGACCAGCCAGACGAAGGTGCTGAAACAGCTGCTGATGCTACAGTCCCTGGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301078
Insert Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301078.1
RefSeq Size 1007 bp
RefSeq ORF 471 bp
Locus ID 1175
UniProt ID P53680
Cytogenetics 19q13.32
Protein Pathways Endocytosis, Huntington's disease
MW 18.4 kDa
Gene Summary One of two major clathrin-associated adaptor complexes, AP-2, is a heterotetramer which is associated with the plasma membrane. This complex is composed of two large chains, a medium chain, and a small chain. This gene encodes the small chain of this complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) contains an alternate 5' terminal exon, initiates translation at an alternate start codon and uses an alternate in-frame splice site in the 5' coding region, compared to variant 3. It encodes isoform 4, which is shorter and has a distinct N-terminus, compared to isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.