RGS20 (NM_001286674) Human Untagged Clone

CAT#: SC333988

RGS20 (untagged) - Human regulator of G-protein signaling 20 (RGS20), transcript variant 4


  "NM_001286674" in other vectors (2)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-RGS20 Antibody
    • 100 ul

USD 485.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "RGS20"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RGS20
Synonyms g(z)GAP; gz-GAP; RGSZ1; ZGAP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333988 representing NM_001286674.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGAGACCTCAGGGCTGTTCCTGATATCAAGCCCTGCTCCTACTCTGGAAGAAGTCAACGCCTGG
GCTCAGTCATTTGACAAATTAATGGTCACTCCAGCAGGAAGGAATGCATTCCGTGAATTCCTCCGAACA
GAATTCAGTGAGGAAAATATGCTCTTCTGGATGGCCTGTGAGGAACTGAAAAAGGAAGCTAATAAAAAC
ATTATTGAAGAGAAAGCAAGGATAATCTATGAAGACTACATTTCTATACTTTCTCCTAAGGAGGTGAGC
TTAGACTCCCGGGTGAGAGAAGTGATCAACAGAAACATGGTGGAGCCATCCCAACACATATTCGATGAT
GCTCAACTTCAGATTTACACCCTGATGCACAGAGACTCATATCCTCGATTCATGAACTCTGCTGTCTAT
AAGGACTTGCTTCAGTCCTTATCGGAGAAATCTATTGAAGCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286674
Insert Size 459 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286674.1
RefSeq Size 1527 bp
RefSeq ORF 459 bp
Locus ID 8601
UniProt ID O76081
Cytogenetics 8q11.23
Protein Families Druggable Genome
MW 17.7 kDa
Gene Summary The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (4) lacks three in-frame exons in the central coding region which results in the use of an alternate start codon compared to variant 1. The encoded isoform (d) is shorter and has a distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.