HSPA14 (NM_001278205) Human Untagged Clone

CAT#: SC333904

HSPA14 (untagged) - Human heat shock 70kDa protein 14 (HSPA14), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HSPA14
• Synonyms: HSP70-4; HSP70L1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC333904 representing NM_001278205.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGCCATCGGAGTTCACCTGGGCTGCACCTCAGCCTGTGTGGCCGTCTATAAGGATGGCCGGGCT
  GGTGTGGTTGCAAATGATGCCGGTGACCGAGTTACTCCAGCTGTTGTTGCTTACTCAGAAAATGAAGAG
  ATTGTTGGATTGGCAGCAAAACAAAGTAGAATAAGAAATATTTCAAATACAGTAATGAAAGTAAAGCAG
  ATCCTGGGCAGAAGGGTGCTCTCAAGGGACCCCCAGCTACAGCAGCTCCCACAGCCTTTTCAGAGGTGC
  AGTTGCTCCCTGTCAGAGCAGCCCCATGGCCAGACTGGGTGTGTCCGGGGAGCCCAGCCCCTGCACCAG
  CACCAACCGCAGCACTCCTGGGGTAGCCTCCACACCGCAGACTCCAGTCTCCTCTTCGAGAGCTGGTTT
  TGTTTCTGGTGGGGATAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278205
• Insert Size: 432 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278205.1
• RefSeq Size: 4110 bp
• RefSeq ORF: 432 bp
• Locus ID: 51182
• Cytogenetics: 10p13
• Protein Families: Druggable Genome, Stem cell - Pluripotency
• MW: 15.7 kDa
• Gene Summary: Component of the ribosome-associated complex (RAC), a complex involved in folding or maintaining nascent polypeptides in a folding-competent state. In the RAC complex, binds to the nascent polypeptide chain, while DNAJC2 stimulates its ATPase activity.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) contains an alternate 3' exon in place of the last several exons compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.