Sumo 3 (SUMO3) (NM_001286416) Human Untagged Clone
CAT#: SC333883
SUMO3 (untagged) - Human small ubiquitin-like modifier 3 (SUMO3), transcript variant 2
"NM_001286416" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "Sumo 3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | Sumo 3 |
Synonyms | SMT3A; Smt3B; SMT3H1; SUMO-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333883 representing NM_001286416.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCGAGGAGAAGCCCAAGGAGGGTGTGAAGACAGAGAATGACCACATCAACCTGAAGGTGGCCGGG CAGGACGGCTCCGTGGTGCAGTTCAAGATCAAGAGGCACACGCCGCTGAGCAAGCTGATGAAGGCCTAC TGCGAGAGGCAGGTGCGGCACCTTGCTCCCCCGCAGAGCCTCCCCGTGTGCGCACTGGTCCTGTGCGTT CCAGGCATCCCCAGAGCACGAGCGTCTCGGGGCTGGACCCAGATGCAGCTGCCCGAGGGCTTGTCAATG AGGCAGATCAGATTCAGGTTCGACGGGCAGCCAATCAATGAAACTGACACTCCAGCACAGCTGGAGATG GAGGACGAGGACACCATCGACGTGTTCCAGCAGCAGACGGGAGGTGTGCCGGAGAGCAGCCTGGCAGGG CACAGTTTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286416 |
Insert Size | 426 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001286416.1 |
RefSeq Size | 1945 bp |
RefSeq ORF | 426 bp |
Locus ID | 6612 |
UniProt ID | P55854 |
Cytogenetics | 21q22.3 |
Protein Families | Druggable Genome |
MW | 15.8 kDa |
Gene Summary | This gene encodes a member of the small ubiquitin-related modifier (SUMO) family of eukaryotic proteins. The encoded protein is covalently conjugated to other proteins via a post-translation modification known as sumoylation. Sumoylation may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Alternatively spliced transcript variants encoding distinct proteins have been described. [provided by RefSeq, Feb 2014] Transcript Variant: This variant (2) uses an alternate in-frame acceptor splice site compared to variant 1. The resulting longer isoform (2) has an internal protein segment not found in isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.