C11orf51 (ANAPC15) (NM_001278489) Human Untagged Clone
CAT#: SC333676
ANAPC15 (untagged) - Human anaphase promoting complex subunit 15 (ANAPC15), transcript variant 6
"NM_001278489" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "ANAPC15"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ANAPC15 |
Synonyms | APC15; C11orf51; HSPC020 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333676 representing NM_001278489.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCCACTTTGTTCCCCTCACTCTTCCCTCGTGTGACTGAGACTCTGTGGTTTAATCTGGATCGACCC TGTGTGGAAGAGACAGAGCTGCAGCAGCAGGAACAGCAGCATCAGGCCTGGCTCCAAAGCATCGCGGAG AAAGACAACAACCTGGTTCCTATTGGCAAGCCAGCCTCAGAGCACTATGATGACGAGGAAGAAGAGGAT GATGAAGATGATGAGGATAGTGAAGAGGACTCAGAGGATGATGAGGATATGCAGGACATGGACGAGATG AATGACTACAATGAGTCACCGGATGATGGAGAGGTCAATGAGGTGGACATGGAAGGCAACGAACAGGAT CAGGACCAGTGGATGATCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278489 |
Insert Size | 366 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278489.1 |
RefSeq Size | 852 bp |
RefSeq ORF | 366 bp |
Locus ID | 25906 |
UniProt ID | P60006 |
Cytogenetics | 11q13.4 |
MW | 14.3 kDa |
Gene Summary | Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. In the complex, plays a role in the release of the mitotic checkpoint complex (MCC) from the APC/C: not required for APC/C activity itself, but promotes the turnover of CDC20 and MCC on the APC/C, thereby participating in the responsiveness of the spindle assembly checkpoint. Also required for degradation of CDC20.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) differs in the 5' UTR andz uses an alternate in-frame splice junction at the 5' end of the last exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.