NKAIN2 (NM_001300738) Human Untagged Clone

CAT#: SC333653

NKAIN2 (untagged) - Human Na+/K+ transporting ATPase interacting 2 (NKAIN2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NKAIN2
• Synonyms: FAM77B; NKAIP2; TCBA; TCBA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC333653 representing NM_001300738.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAAACAGACCTTATCCTGACTTTTAATATATCAATGCACCGATCTTGGTGGATGGAGAATGGACCA
  GGATGTACGGTGACGTCAGTGACACCTGCCCCAGACTGGGCCCCAGAAGACCATCGCTACATCACGGTC
  TCAGGGTGTTTGCTGGAGTACCAGTACATAGAAGTGGCTCATAGTTCCCTCCAGATTGTCCTCGCACTG
  GCAGGTTTCATCTACGCCTGTTATGTTGTGAAATGTATAACTGAAGAAGAGGACAGCTTTGATTTCATA
  GGTGGCTTTGACTCTTATGGCTATCAAGGGCCTCAGAAGACATCTCATTTACAACTACAGCCTATGTAC
  ATGTCAAAATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300738
• Insert Size: 357 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300738.1
• RefSeq Size: 3407 bp
• RefSeq ORF: 357 bp
• Locus ID: 154215
• UniProt ID: Q5VXU1
• Cytogenetics: 6q22.31
• Protein Families: Transmembrane
• MW: 13.4 kDa
• Gene Summary: This gene encodes a transmembrane protein that interacts with the beta subunit of a sodium/potassium-transporting ATPase. A chromosomal translocation involving this gene is a cause of lymphoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (4) has an alternate exon in its 5' end compared to variant 1. This variant represents translation initiation at a downstream AUG compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG to encode an isoform (4) that has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.