MDMX (MDM4) (NM_001278518) Human Untagged Clone
CAT#: SC333625
MDM4 (untagged) - Human MDM4, p53 regulator (MDM4), transcript variant 6
"NM_001278518" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "MDMX"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MDMX |
Synonyms | BMFS6; HDMX; MDMX; MRP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333625 representing NM_001278518.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAA ATCAATCAGGTACGACCAAAACTGCCGCTTTTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATG TTCACTGTTAAAGAGGTCATGCACTATTTAGGTCAGTACATAATGGTGAAGCAACTTTATGATCAGCAG GAGCAGCATATGGTATATTGTGGTGGAGATCTTTTGGGAGAACTACTGGGACGTCAGAGCTTCTCCGTG AAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTTAGCCACTGCTACTACAGGT GATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278518 |
Insert Size | 351 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278518.1 |
RefSeq Size | 9611 bp |
RefSeq ORF | 351 bp |
Locus ID | 4194 |
UniProt ID | O15151 |
Cytogenetics | 1q32.1 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | p53 signaling pathway |
MW | 12.8 kDa |
Gene Summary | This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (6, also known as MDM4-ALT1, XALT1, or HDMX-ALT1) lacks four consecutive exons compared to variant 1. The resulting isoform (6) has a shorter and distinct C-terminus compared to isoform 1. Annotation of this protein causes this transcript to be a candidate for nonsense-mediated mRNA decay (NMD); however, since transcript variant 4 escapes NMD, it is likely that isoform 6 is also biologically valid. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.